Prev. |  KEGG KO K04730 > 

RIKEN DNA Bank Human Resource - IRAK1

Gene ID NCBI Gene 3654 |  KEGG hsa:3654
Gene Symbol IRAK1
Protein Name interleukin 1 receptor associated kinase 1
Synonyms IRAK|pelle
Ortholog resources KEGG ortholog (KEGG orthology K04730) in the DNA Bank
Featured content MAPK p38 inhibitor screening
Featured content NF-kappa B signaling pathway (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB16723 pEF6-FLAG-human IRAK1 Expression vector of human IRAK1 tagged with FLAG.

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046335 IRAK115N23 pCMV-SPORT6 BC054000 NM_001569 Full/var
HGY093980 IRAL034P20 pOTB7 BC014963 NM_001025243 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043328 ARe08F08 pKA1U5 NM_001025242.1  
GGTCCTCTTGCGTGTCCAAAAGTAGCCCAGGGCTGTAGCACAGGCTTCACAGNTGATTTT
HKR191603 ARi79A03 pGCAP10 NM_001025242.1  
GGGACCCGGCCGGCCCAGGCCCGCGCCCGCCGCGGCCCTGAGAGGCCCCGGCAGGTCCCG
HKR385351 RBd63G07 pGCAP10 NM_001025242.1  
GGGCCGGCCCAGGCCCGCGCCCGCCGCGGCCCTGAGAGGCCCCGGCAGGTCCCGGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.07.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl