RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - INPPL1

Gene ID	NCBI Gene 3636 \| KEGG hsa:3636
Gene Symbol	INPPL1
Protein Name	inositol polyphosphate phosphatase like 1
Synonyms	OPSMD\|SHIP2
Featured content	B cell receptor signaling pathway (human)

Ortholog resource in our bank

  INPPL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number	Name of Resource	Description
RDB15719	pEGFP-C1-SHIP2	Expression vector of human SH2-containing inositol phosphatase-2 (SHIP2), fused with N-terminal GFP.

webcatalog20220516.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR430163	RBdS075G19	pGCAP10	NM_001567.3	Full
HKR430163	GATCTTAAGTGGCCGCCTGGAGCCCAGGGCCGCTGTCCGGGGAAGGGGGCGCCGGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl