Prev. |  KEGG KO K15909 > 

RIKEN DNA Bank Human Resource - INPPL1

Gene ID NCBI Gene 3636 |  KEGG hsa:3636
Gene Symbol INPPL1
Protein Name inositol polyphosphate phosphatase like 1
Synonyms OPSMD|SHIP2
Featured content B cell receptor signaling pathway (human)
Ortholog resource in our bank

  INPPL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB15719 pEGFP-C1-SHIP2 Expression vector of human SH2-containing inositol phosphatase-2 (SHIP2), fused with N-terminal GFP.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR430163 RBdS075G19 pGCAP10 NM_001567.3 done
GATCTTAAGTGGCCGCCTGGAGCCCAGGGCCGCTGTCCGGGGAAGGGGGCGCCGGAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.07.13

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl