Prev. |  KEGG KO K01109 > 

RIKEN DNA Bank Human Resource - INPP4A

Gene ID NCBI Gene 3631 |  KEGG hsa:3631
Gene Symbol INPP4A
Protein Name inositol polyphosphate-4-phosphatase type I A
Synonyms INPP4|TVAS1
Ortholog resource in our bank

  INPP4A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013804 IRAK034I12 pBluescriptR BC028361 NM_004027 Full/var
HGY087399 IRAL018I07 pOTB7 BC005082 NM_001566 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089621 M01C024A21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089669 M01C024C21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089717 M01C024E21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089765 M01C024G21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089813 M01C024I21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089861 M01C024K21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089909 M01C024M21 pDONR221 MGC01-E11 BC028361 ENST00000074304  
HGE089957 M01C024O21 pDONR221 MGC01-E11 BC028361 ENST00000074304  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405408 RBdS013I16 pGCAP10 NM_001566.2  
GAGGGCTGCGGCGCGCGTGGAGGGTTCGCTGCTGGTTTGCCGCCGGGTCGGGCTCCGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl