Prev. |  KEGG KO K01107 > 

RIKEN DNA Bank Human Resource - INPP1

Gene ID NCBI Gene 3628 |  KEGG hsa:3628
Gene Symbol INPP1
Protein Name inositol polyphosphate-1-phosphatase
Synonyms -
Ortholog resource in our bank

  INPP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008146 IRAK020G02 pCMV-SPORT6 BC015496 NM_002194 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR161675 ARi04D03 pGCAP10 NM_002194.3  
CGGCCGGCCGATGCTCTCCTCCTGCTCCCCGCCGCTTCCGTTTCTCGAGGGAAAGGCT
HKR173345 ARi33G01 pGCAP10 NM_002194.3  
GGTCCCCGCGCCGCTGCCCCTCCTCCTTGGATCTGGGGCCCGGGCTGGTGAGCGGCGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl