Prev. |  KEGG KO K00088 > 

RIKEN DNA Bank Human Resource - IMPDH1

Gene ID NCBI Gene 3614 |  KEGG hsa:3614
Gene Symbol IMPDH1
Protein Name inosine monophosphate dehydrogenase 1
Synonyms IMPD|IMPD1|IMPDH-I|LCA11|RP10|sWSS2608
Ortholog resource in our bank

  IMPDH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025820 IRAK064J04 pCMV-SPORT6 BC033622 NM_183243 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051301 ARe28E05 pKA1U5 NM_000883.3  
AGTAGCAGCAGCAGCAGCGGCGGCAGCGGCGGGCGGCCGCGCGGGTGTTTATGTCGGGTC
HKR052029 ARe30B05 pKA1U5 NM_000883.3  
GACTCACTGCCCAGCCGGGGCCCCGGGAGCCTCCAGGCTCCCGCCCGCCCTGAGCTGCGG
HKR367234 RBd18B10 pGCAP10 NM_000883.3  
GGCCCAGCCGGGGCCCCGGGAGCCTCCAGGCTCCCGCCCGCCCTGAGCTGCGGCCTCCGC
HKR403075 RBdS007L11 pGCAP10 NM_000883.3  
GAGCCGGGGCCCCGGGAGCCTCCAGGCTCCCGCCCGCCCTGAGCTGCGGCCTCCGCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl