Prev. |  KEGG KO K01092 > 

RIKEN DNA Bank Human Resource - IMPA1

Gene ID NCBI Gene 3612 |  KEGG hsa:3612
Gene Symbol IMPA1
Protein Name inositol monophosphatase 1
Synonyms IMP|IMPA|MRT59
Ortholog resource in our bank

  IMPA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086597 IRAL016I05 pDNR-LIB BC008381 NM_005536 Full
HGY086741 IRAL016O05 pDNR-LIB BC009565 NM_005536 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR184460 ARi61C12 pGCAP10 NM_005536.3  
TGGGAAGAGACGAGTGCGGTAACACCGTTCACAGAGCTAGCCGGACGTCCTCCGACTCAA
HKR205510 ARiS013M22 pGCAP10 NM_005536.3  
GAGCCCCTCTACCTCCNGAAGAGACGAGTGCGGTAACACCGTTCACAGAGCTAGCCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl