Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - ILK

Gene ID (NCBI) 3611
Gene Symbol ILK
Protein Name integrin linked kinase
Synonyms HEL-S-28|ILK-1|ILK-2|P59|p59ILK
Databases KEGG hsa:3611 |  NCBI Gene 3611
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06272)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05226 pAxCALNLhILK(forward) Shuttle vector to generate rAd expressing human ILK
RDB05227 pAxCALNLhILK(reverse) Shuttle vector to generate rAd expressing human ILK

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001606 IRAK004A06 pCMV-SPORT6 BC001554 NM_004517 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007087 W01A017L23 pENTR-TOPO IRAK004A06 BC001554 NM_004517  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042505 ARe06E09 pKA1U5 NM_004517.2  
TGGGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGAGTCCCGTCCTCAGG
HKR043770 ARe09H02 pKA1U5 NM_004517.2  
GGGGGCCGGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGC
HKR172170 ARi30H02 pGCAP10 NM_004517.2  
GGCCGGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGC
HKR056951 ARe42G07 pKA1U5 NM_004517.2  
GAGAGAAGGATCCTGCAGCCCGAGTCCCGTCCTCAGGCTTCCCCAATCCAGGGGACTCGG
HKR176879 ARi42D07 pGCAP10 NM_004517.2  
GGGAGAAGGATCCTGCAGCCCGAGTCCCGTCCTCAGGCTTCCCCAATCCAGGGGACTCGG
HKR181371 ARi53H03 pGCAP10 NM_004517.2  
GGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGAGTCCCGAGGATAAAGC
HKR188126 ARi70F06 pGCAP10 NM_004517.2  
GGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGAGTCCCGAGGATAAA
HKR203543 ARiS008O07 pGCAP10 NM_004517.2  
GGCGGCGGGCTGCNGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGA
HKR243676 ARiS109D04 pGCAP10 NM_004517.2  
GGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGA
HKR243918 ARiS109N06 pGCAP10 NM_004517.2  
GGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGCAGCCCGA
HKR364947 RBd12G03 pGCAP10 NM_004517.2  
GGGGGCCGGCGGCGGGCTGCGGGCGCGGCCGGACGGGAGTTCCCCGGAGAAGGATCCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.02.22

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl