Prev. |  KEGG KO K13090 > 

RIKEN DNA Bank Human Resource - ILF3

Gene ID NCBI Gene 3609 |  KEGG hsa:3609
Gene Symbol ILF3
Protein Name interleukin enhancer binding factor 3
Synonyms CBTF|DRBF|DRBP76|MMP4|MPHOSPH4|MPP4|MPP4110|NF-AT-90|NF110|NF110b|NF90|NF90a|NF90b|NF90c|NF90ctv|NFAR|NFAR-1|NFAR-2|NFAR110|NFAR2|NFAR90|TCP110|TCP80
Ortholog resource in our bank

  ILF3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037238 IRAK093B14 pCMV-SPORT6 BC048314 NM_153464 Partial/var
HGX056628 IRAK141J12 pCMV-SPORT6 BC064836 NM_004516 Full/var
HGY082535 IRAL006F15 pOTB7 BC001770 NM_153464 Partial
HGY089715 IRAL024E19 pOTB7 BC018633 NM_153464
HGY092042 IRAL030B18 pOTB7 BC014221 NM_153464

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE010918 W01A027E22 pENTR-TOPO flj0063i20 AK000018 NM_153464  
HGE011885 W01A029L21 pENTR-TOPO IRAK141J12 BC064836 NM_004516  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234034 ARiS085B10 pGCAP10 NM_153464.2  
GGGACTCCTCCTCCTCCTCTTCTCGCCATTGCAGTTGGACCCAGCAGCCCGGCGCGCACC
HKR323277 RBb08D05 pKA1U5 NM_153464.2  
GGCACGCTGCCTTGGAGCACACACCCCCTTCGGGNTCCCNTAGATTCCGCGGCGGGGCGA
HKR405520 RBdS013N08 pGCAP10 NM_153464.2  
AGACCTCCCCGGCGCGCGCCTGCCCGCCCGCCCGCTCGCCCCCGGTCCGGACTCCTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl