Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IL13RA1

Gene ID (NCBI) 3597
Gene Symbol IL13RA1
Protein Name interleukin 13 receptor subunit alpha 1
Synonyms CD213A1|CT19|IL-13Ra|NR4
Databases KEGG hsa:3597 |  NCBI Gene 3597
Featured content Jak-STAT signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05076)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07610 pcDNA3.1(+)-hIL13Ra1 Expression vector of human IL13Ra1

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY090713 IRAL026N01 pOTB7 BC009960 NM_001560 Full
HGY093859 IRAL034K19 pOTB7 BC015768 NM_001560 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE037865 W01A094L01 pENTR-TOPO IRAL026N01 BC009960 NM_001560  
HGE037877 W01A094L13 pENTR-TOPO IRAL026N01 BC009960 NM_001560  
HGE046970 W01A117H02 pENTR-TOPO IRAL026N01 BC009960 NM_001560  
HGE046976 W01A117H08 pENTR-TOPO IRAL026N01 BC009960 NM_001560  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183212 ARi58A12 pGCAP10 NM_001560.2  
GCCCCGTCTGCGCCGGCCCCCAGCCTCCAGGGCGGCGGAGCCGGGAAGTGGAAGAGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl