Prev. |  KEGG KO K06829 > 

RIKEN DNA Bank Human Resource - CYR61

Gene ID NCBI Gene 3491 |  KEGG hsa:3491
Gene Symbol CYR61
Protein Name cysteine rich angiogenic inducer 61
Synonyms CCN1|GIG1|IGFBP10
Ortholog resources KEGG ortholog (KEGG orthology K06829) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001777 IRAK004H09 pCMV-SPORT6 BC001271 NM_001554 Full
HGX008868 IRAK022C20 pCMV-SPORT6 BC016952 NM_001554 Full
HGY089722 IRAL024F02 pOTB7 BC009199 NM_001554

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041752 ARe04G08 pKA1U5 NM_001554.4  
ATGAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCC
HKR042079 ARe05D07 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR044924 ARe12F04 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR045353 ARe13G09 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR051724 ARe29F04 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR052802 ARe32A02 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR054075 ARe35D03 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR061705 ARe54E09 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR062555 ARe56G11 pKA1U5 NM_001554.4  
GAGACCGCGAGCGATAGCGCCCCCGAGCAGCGCCCNTAAAGNTCCGCGCCTTCTCCGCCG
HKR066833 ARe67B09 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR066884 ARe67D12 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR067298 ARe68E02 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR068147 ARe70G03 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGNTGCCCTCCGCGCCTTCTCCGCCG
HKR069330 ARe73F10 pKA1U5 NM_001554.4  
GAGACCGCGCAGCGCAGAGCGCCCCCGAAGCAGCGCCCGNTNNCCTCCGCGCCTTCTCCG
HKR070402 ARe76A02 pKA1U5 NM_001554.4  
GANACCGCGCAGCGANAGCGCCCCCGAGCAGCGCCCNTNAACCTCCGCGCCTTCTCCGCC
HKR070550 ARe76G06 pKA1U5 NM_001554.4  
GAGACCGCGCAGCGAGAGCGCCCCCGAGCAGCGCCCNTTNNCCTCCGCGCCTTCTCCGCC
HKR072453 ARe81C05 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR072884 ARe82D12 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR075322 ARe88F02 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR078503 ARe96E07 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR078925 ARe97F05 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR080482 ARf01D10 pKA1U5 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR163259 ARi08C11 pGCAP10 NM_001554.4  
GGAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCG
HKR164931 ARi12F11 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR166033 ARi15B09 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR166858 ARi17C10 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR166898 ARi17E02 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR166954 ARi17G10 pGCAP10 NM_001554.4  
CGGCCGGCCGATGAGACCGCGAGCGAGAGCGCCCCCGAGCANNNCCCGCGCCCTCCGCGC
HKR167673 ARi19D01 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR168554 ARi21G10 pGCAP10 NM_001554.4  
TGAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCG
HKR169321 ARi23F01 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCTCGCCTTCTCCGCCGG
HKR171746 ARi29G02 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR172854 ARi32C06 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR173652 ARi34C04 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR175230 ARi38B06 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR184059 ARi60C11 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR185352 ARi63G08 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR185745 ARi64G01 pGCAP10 NM_001554.4  
CGGCCGGCCGATGAGACCGCGAGCGAGAGCGCCCCNAGCAGCGCCNCGCCNTCNGCGCNTTCT
HKR186101 ARi65E05 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR186148 ARi65G04 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR203455 ARiS008K15 pGCAP10 NM_001554.4  
GAGACNNNNAGCGANAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR209453 ARiS023K13 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR218019 ARiS045A19 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR218165 ARiS045G21 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR219603 ARiS049A03 pGCAP10 NM_001554.4  
GAAGAAATACCGGCCCAAGTACTGCGGTTCCTGCGTGGACGGCCGATGCTGCACGCCCCA
HKR222008 ARiS055A08 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR234287 ARiS085L23 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR235016 ARiS087I24 pGCAP10 NM_001554.4  
HKR235366 ARiS088G22 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR238505 ARiS096E09 pGCAP10 NM_001554.4  
GAGACCGCNAGCGAGAGCGCCCCCNANCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR238645 ARiS096K05 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR247253 ARiS118C05 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR247401 ARiS118I09 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCNAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR276653 ARiS191K13 pGCAP10 NM_001554.4  
GAGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGG
HKR277652 ARiS194C04 pGCAP10 NM_001554.4  
GGACCGCGAGCGAGAGCGCCCCCGAGCAGCGCCCGCGCCCTCCGCGCCTTCTCCGCCGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl