Prev. | 

RIKEN DNA Bank Human Resource - IGFBP6

Gene ID NCBI Gene 3489 |  KEGG hsa:3489
Gene Symbol IGFBP6
Protein Name insulin like growth factor binding protein 6
Synonyms IBP6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085290 IRAL013D18 pOTB7 BC005007 NM_002178 Full
HGY085555 IRAL013O19 pOTB7 BC003507 NM_002178 Full
HGY090987 IRAL027H19 pOTB7 BC010162 NM_002178 Full
HGY090989 IRAL027H21 pOTB7 BC011708 NM_002178 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063684 ARe59D12 pKA1U5 NM_002178.2  
AGCTGCGCTGCGACTGCTCTGGAAGGAGAGGACGGGGCACAAACCCTGACCATGACCCCC
HKR064002 ARe60A02 pKA1U5 NM_002178.2  
GAGCTGCGCTGCGACTGCTCTGGAAGGAGAGGACGGGGCACAAACCCTGACCATGACCCC
HKR170078 ARi25D06 pGCAP10 NM_002178.2  
GAGCTGTGCTGCGACTGCTCTGGAAGGAGAGGACGGGGCACAAACCCTGACCATGACCCC
HKR174801 ARi37A01 pGCAP10 NM_002178.2  
TGAGCTGCGCTGCGACTGCTCTGGAAGGAGAGGACGGGGCACAAACCCTGACCATGACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl