Prev. |  KEGG KO K10138 > 

RIKEN DNA Bank Human Resource - IGFBP3

Gene ID NCBI Gene 3486 |  KEGG hsa:3486
Gene Symbol IGFBP3
Protein Name insulin like growth factor binding protein 3
Synonyms BP-53|IBP3
Ortholog resource in our bank

  IGFBP3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07568 pGL4-phIGFBP3 Promoter collection, Human IGFBP3 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100104 IRAL050E08 pOTB7 BC064987 NM_000598 Full
HGY082900 IRAL007E04 pOTB7 BC000013 NM_000598 Full/var
HGY090870 IRAL027C22 pOTB7 BC018962 NM_000598 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050028 ARe25B04 pKA1U5 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR060551 ARe51G07 pKA1U5 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR062550 ARe56G06 pKA1U5 NM_000598.4  
GATGCNAGCACTGTCTGCTGGNCGCTGAGGATCCCCCGTATTCCTGCNTGGATTCCNCAG
HKR067228 ARe68B04 pKA1U5 NM_000598.4  
GGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAGC
HKR068504 ARe71E08 pKA1U5 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR071659 ARe79C11 pKA1U5 NM_000598.4  
GGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAGCTTC
HKR081607 ARf04A07 pKA1U5 NM_000598.4  
GANATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGNCGCTTCCTGCCTGGATTCCACAG
HKR163376 ARi08H08 pGCAP10 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR179345 ARi48G01 pGCAP10 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR180401 ARi51A01 pGCAP10 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR187658 ARi69C10 pGCAP10 NM_000598.4  
GAGATGCGAGCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG
HKR209362 ARiS023G18 pGCAP10 NM_000598.4  
GAGANNNNNCNNACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACA
HKR264539 ARiS161F19 pGCAP10 NM_000598.4  
GAGATGCNANCACTGCGGCTGGGCGCTGAGGATCAGCCGCTTCCTGCCTGGATTCCACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl