Prev. |  KEGG KO K17606 > 

RIKEN DNA Bank Human Resource - IGBP1

Gene ID NCBI Gene 3476 |  KEGG hsa:3476
Gene Symbol IGBP1
Protein Name immunoglobulin binding protein 1
Synonyms ALPHA-4|IBP1|alpha4
Ortholog resource in our bank

  IGBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081128 IRAL002N16 pOTB7 BC004137 NM_001551

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075684 ARe89D12 pKA1U5 NM_001551.2  
NGCNCTCTCCCGNAGCACGGTTGTGNGCAGCGACGAGCCNANNTCNTGCCGCGGANTCCC
HKR409160 RBdS022O24 pGCAP10 NM_001551.2  
GCTGAAAATCACACTGCCAATTCCTCCATGGCTTATCCTAGTCTCGTTGCTATGGCATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl