Prev. | 

RIKEN DNA Bank Human Resource - IFRD1

Gene ID NCBI Gene 3475 |  KEGG hsa:3475
Gene Symbol IFRD1
Protein Name interferon related developmental regulator 1
Synonyms PC4|TIS7
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001944 IRAK004O08 pCMV-SPORT6 BC001272 NM_001550 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR073603 ARe84A03 pKA1U5 NM_001550.2  
GGCCTTAGCTCCCGCGCTAGAGAGAAACATGTATCGTTTTCGATCACAGCTCTTCACGGG
HKR173255 ARi33C07 pGCAP10 NM_001550.2  
GCCTTAGCTCCCGCGCTAGAGAGAAACATGTATCGTTTTCGATCACAGCTCTTCACGGGG
HKR365654 RBd14C06 pGCAP10 NM_001550.2  
GGCCTTAGCTCCCGCGCTAGAGAGAAACATGTATCGTTTTCGATCACAGCTCTTCACGGG
HKR395612 RBd89A12 pGCAP10 NM_001550.2  
GGCCTTAGCTCCCGCGCTAGAGAGAAACATGTATCGTTTTCGATCACAGCTCTTCACGGG
HKR474878 RBdS187D06 pGCAP10 NM_001550.2  
GGCCTTAGCTCCCGCGCTAGAGAGAAACATGTATCGTTTTCGATCACAGCTCTTCACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl