Prev. |  KEGG KO K05133 > 

RIKEN DNA Bank Human Resource - IFNGR2

Gene ID NCBI Gene 3460 |  KEGG hsa:3460
Gene Symbol IFNGR2
Protein Name interferon gamma receptor 2
Synonyms AF-1|IFGR2|IFNGT1|IMD28
Featured content Jak-STAT signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  IFNGR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081457 IRAL003K17 pOTB7 BC003624 NM_005534 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014520 W01A036E24 pENTR-TOPO IRAL003K17 BC003624 NM_005534  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172948 ARi32G04 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR222154 ARiS055G10 pGCAP10 NM_005534.3  
GGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGC
HKR247440 ARiS118J24 pGCAP10 NM_005534.3  
GGCTGCTCGGGAAGAGGCGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGC
HKR387684 RBd69D12 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR403049 RBdS007K09 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR442038 RBdS105B14 pGCAP10 NM_005534.3  
GAAGAGGCGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl