Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IFNGR2

Gene ID (NCBI) 3460
Gene Symbol IFNGR2
Protein Name interferon gamma receptor 2 (interferon gamma transducer 1)
Synonyms AF-1|IFGR2|IFNGT1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Jak-STAT signaling pathwa (human)
Featured content HIF-1 signaling pathway - human


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY081457 IRAL003K17 pOTB7 BC003624 NM_005534 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014520 W01A036E24 pENTR-TOPO IRAL003K17 BC003624 NM_005534  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172948 ARi32G04 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR222154 ARiS055G10 pGCAP10 NM_005534.3  
GGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGC
HKR247440 ARiS118J24 pGCAP10 NM_005534.3  
GGCTGCTCGGGAAGAGGCGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGC
HKR387684 RBd69D12 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR403049 RBdS007K09 pGCAP10 NM_005534.3  
GGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCGGCTCCGCGGACCCCGAGC
HKR442038 RBdS105B14 pGCAP10 NM_005534.3  
GAAGAGGCGGGCCCTGCGCGCCCTGCGCTCGCCATGGCGGTTTGGGCGGCGACGTGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.17

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl