Prev. |  KEGG KO K05131 > 

RIKEN DNA Bank Human Resource - IFNAR2

Gene ID NCBI Gene 3455 |  KEGG hsa:3455
Gene Symbol IFNAR2
Protein Name interferon alpha and beta receptor subunit 2
Synonyms IFN-R|IFN-alpha-REC|IFNABR|IFNARB|IMD45
Ortholog resources KEGG ortholog (KEGG orthology K05131) in the DNA Bank
Featured content Jak-STAT signaling pathway (human)
Featured content Toll-like receptor signaling pathway - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085087 IRAL012L23 pOTB7 BC002793 NM_207584 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162926 ARi07F06 pGCAP10 NM_207584.1  
GGCCCCCGCGCCGGCGGCGGCGCGGCGCCCGCGCTTCCGTAGCGCTCCTCGTAGGCCGGG
HKR276564 ARiS191G20 pGCAP10 NM_207584.1  
GCCCCCGCCCCCGCGCCGGCGGCGGCGCGGCGCCCGCGCTTCCGTAGCGCTCCTCGTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl