Prev. |  KEGG KO K05131 > 

RIKEN DNA Bank Human Resource - IFNAR2

Gene ID NCBI Gene 3455 |  KEGG hsa:3455
Gene Symbol IFNAR2
Protein Name interferon alpha and beta receptor subunit 2
Synonyms IFN-R|IFN-alpha-REC|IFNABR|IFNARB|IMD45
Featured content Jak-STAT signaling pathway (human)
Featured content Toll-like receptor signaling pathway - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  IFNAR2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085087 IRAL012L23 pOTB7 BC002793 NM_207584 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR162926 ARi07F06 pGCAP10 NM_207584.1  
GGCCCCCGCGCCGGCGGCGGCGCGGCGCCCGCGCTTCCGTAGCGCTCCTCGTAGGCCGGG
HKR276564 ARiS191G20 pGCAP10 NM_207584.1  
GCCCCCGCCCCCGCGCCGGCGGCGGCGCGGCGCCCGCGCTTCCGTAGCGCTCCTCGTAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl