DNA Bank Top |  KEGG KO K05130 > 

RIKEN DNA Bank Human Resource - IFNAR1

Gene ID NCBI Gene 3454 |  KEGG hsa:3454
Gene Symbol IFNAR1
Protein Name interferon alpha and beta receptor subunit 1
Synonyms AVP|IFN-alpha-REC|IFNAR|IFNBR|IFRC|IMD106
Featured content Jak-STAT signaling pathway (human)
Featured content Toll-like receptor signaling pathway - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  IFNAR1

External database

human IFNAR1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04722 pAxCALNLhIFNAR1(reverse) Shuttle vector to generate rAd expressing human IFNAR1    
RDB04637 pAxCALNLhIFNAR1(forward) Shuttle vector to generate rAd expressing human IFNAR1    
RDB04636 pAxCALNLhIFNAR1(reverse) Shuttle vector to generate rAd expressing human IFNAR1    
RDB04626 pAxCALNLhIFNAR1(forward) Shuttle vector to generate rAd expressing human IFNAR1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011929 IRAK029N17 pCMV-SPORT6 BC021825 NM_000629 Full
HGX027273 IRAK068D01 pCMV-SPORT6 BC035603 NM_000629 Partial/var
HGY092773 IRAL031P13 pDNR-LIB BC014338 NM_000629 Partial/var
HGY100486 IRAL051D14 pDNR-LIB BC065751 NM_000629 Partial/var
HGY081770 IRAL004H02 pOTB7 BC002590 NM_000629 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE022665 W01A056L01 pENTR-TOPO IRAK029N17 BC021825 NM_000629  
HGE024270 W01A060L06 pENTR-TOPO IRAK029N17 BC021825 NM_000629  
HGE024278 W01A060L14 pENTR-TOPO IRAK029N17 BC021825 NM_000629  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR183348 ARi58G04 pGCAP10 NM_000629.2  
GGTGACTTAGGACGGGGCGATGGCGGCTGANAGGAGCTGCGCGTGCGCGANATGTAACTG
HKR260162 ARiS150G18 pGCAP10 NM_000629.2  
GGCGGTGTGACTTAGGACNGGGCGATGGCGGCTGAAAGGAGCTGCGCGTGCGCGAACATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl