Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IDS

Gene ID (NCBI) 3423
Gene Symbol IDS
Protein Name iduronate 2-sulfatase
Synonyms MPS2|SIDS
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Lysosome (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087513 IRAL018N01 pOTB7 BC006170 NM_006123 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098802 M01C047A02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098850 M01C047C02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098898 M01C047E02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098946 M01C047G02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098994 M01C047I02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099042 M01C047K02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099090 M01C047M02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099138 M01C047O02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE121243 M01C103B19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121291 M01C103D19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121339 M01C103F19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121387 M01C103H19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121435 M01C103J19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121483 M01C103L19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121531 M01C103N19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121579 M01C103P19 pDONR221 06_12-C10 BC006170 ENST00000370443  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172978 ARi32H10 pGCAP10 NM_000202.3  
TCTCGCGCTGCGGCCAGCGCCCGGGCCTGCGGGCCCGGGCGGCGGCTGTGTTGCGCAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.11.19

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl