Prev. |  KEGG KO K01136 > 

RIKEN DNA Bank Human Resource - IDS

Gene ID NCBI Gene 3423 |  KEGG hsa:3423
Gene Symbol IDS
Protein Name iduronate 2-sulfatase
Synonyms ID2S|MPS2|SIDS
Featured content Lysosome (human)
Ortholog resource in our bank

  IDS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087513 IRAL018N01 pOTB7 BC006170 NM_006123 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE121243 M01C103B19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121291 M01C103D19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121339 M01C103F19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121387 M01C103H19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121435 M01C103J19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121483 M01C103L19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121531 M01C103N19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE121579 M01C103P19 pDONR221 06_12-C10 BC006170 ENST00000370443  
HGE098802 M01C047A02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098850 M01C047C02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098898 M01C047E02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098946 M01C047G02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE098994 M01C047I02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099042 M01C047K02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099090 M01C047M02 pDONR221 MGC13-B01 BC006170 ENST00000370443  
HGE099138 M01C047O02 pDONR221 MGC13-B01 BC006170 ENST00000370443  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172978 ARi32H10 pGCAP10 NM_000202.3 done
TCTCGCGCTGCGGCCAGCGCCCGGGCCTGCGGGCCCGGGCGGCGGCTGTGTTGCGCAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl