Prev. |  KEGG KO K01823 > 

RIKEN DNA Bank Human Resource - IDI1

Gene ID NCBI Gene 3422 |  KEGG hsa:3422
Gene Symbol IDI1
Protein Name isopentenyl-diphosphate delta isomerase 1
Synonyms IPP1|IPPI1
Ortholog resource in our bank

  IDI1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03765 SEREX clone NGO-St-089 (ID 560) #1 SEREX clone NGO-St-089 (ID 560) #1

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY053255 IRAK133C07 pBluescript BC057827 NM_004508 Partial
HGY086624 IRAL016J08 pDNR-LIB BC005247 NM_004508 Partial
HGY092965 IRAL032G21 pDNR-LIB BC025375 NM_004508 Partial
HGY094048 IRAL035B24 pDNR-LIB BC022418 NM_004508 Partial
HGY086743 IRAL016O07 pDNR-LIB BC006999 NM_004508 Partial/var
HGY092422 IRAL031A22 pDNR-LIB BC019227 NM_004508 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321356 RBb03G12 pKA1U5 NM_004508.2  
TGGTCTGTGGCCGGAGGCTGATCAGTGTTCTAGAACAGATCAGACATTTTGTAATGATGC
HKR382924 RBd57F04 pGCAP10 NM_004508.2  
GGCTTCCGCCCCGCAGCCCCGAGGGGTCTGGTCGCGCTGAANNNNNNNTCGGCTGCTGGG
HKR405781 RBdS014H13 pGCAP10 NM_004508.2  
GGCGCCGCAGACTGTGCTCAAAGCGGGCGCCATCCGGGACCGGCGGTTGTCTGTGGCCGG
HKR416143 RBdS040F23 pGCAP10 NM_004508.2  
GGTCTGTGGCCGGAGGCTGATCAGGATTATTGCATCGAGCTTTTAGTGTCTTCTTATTCA
HKR432521 RBdS081F01 pGCAP10 NM_004508.2  
GGTCTGTGGCCGGAGGCTGATCAGTGTTCTAGAACAGATCAGACATTTTGTAATGATGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl