Prev. |  KEGG KO K01408 > 

RIKEN DNA Bank Human Resource - IDE

Gene ID NCBI Gene 3416 |  KEGG hsa:3416
Gene Symbol IDE
Protein Name insulin degrading enzyme
Synonyms INSULYSIN
Ortholog resources KEGG ortholog (KEGG orthology K01408) in the DNA Bank
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234881 ARiS087D09 pGCAP10 NM_004969.2  
GACCGGCTAGCGTGGCTTCTGCACCCCGCACTGCCCAGCACCTTCCGCTCAGTCCTCGGC
HKR416376 RBdS040P16 pGCAP10 NM_004969.2  
GGCGCAGGGCCGGCTCGAAGCGCAAGCAGGAAGCGTTTGCGGTGATCCCGGCGACTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl