Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - ID3

Gene ID (NCBI) 3399
Gene Symbol ID3
Protein Name inhibitor of DNA binding 3, dominant negative helix-loop-helix protein
Synonyms HEIR-1|bHLHb25
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17694)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY083224 IRAL008A24 pOTB7 BC003107 NM_002167 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000601 W01A001I09 pENTR-TOPO IRAL008A24 BC003107 NM_002167  
HGE000607 W01A001I15 pENTR-TOPO IRAL008A24 BC003107 NM_002167  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040457 ARe01C09 pKA1U5 NM_002167.3  
GGCGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCT
HKR178578 ARi46H10 pGCAP10 NM_002167.3  
GGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGG
HKR073274 ARe83D02 pKA1U5 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR234850 ARiS087C02 pGCAP10 NM_002167.3  
GGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGG
HKR324176 RBb10H08 pKA1U5 NM_002167.3  
GGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGG
HKR327629 RBb19B05 pKA1U5 NM_002167.3  
GCTCTTCTTTCCCTAAGCAGCCTGAGGGTTGACTGGATTGGTGAGGCCCGTGTGGCTACT
HKR327699 RBb19E03 pKA1U5 NM_002167.3  
GACTCCCCAGCATGAAGGCGCTGAGCCCGGTGCGCGGCTGCTACGAGGCGGTGTGCTGCC
HKR365684 RBd14D12 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR368179 RBd20H11 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR374548 RBd36G04 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR382479 RBd56D07 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR385780 RBd64H12 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR390029 RBd75B05 pGCAP10 NM_002167.3  
TGGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTC
HKR406213 RBdS015I21 pGCAP10 NM_002167.3  
GGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTGG
HKR409164 RBdS022P04 pGCAP10 NM_002167.3  
TGGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTC
HKR432489 RBdS081D17 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT
HKR442255 RBdS105K15 pGCAP10 NM_002167.3  
GCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCTG
HKR471177 RBdS177P17 pGCAP10 NM_002167.3  
GGCGTTGCAGGTCACTGTAGCGGGACTTCTTTTGGTTTTCTTTCTCTTTGGGGCACCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.23

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl