Prev. |  KEGG KO K15033 > 

RIKEN DNA Bank Human Resource - MRPL58

Gene ID NCBI Gene 3396 |  KEGG hsa:3396
Gene Symbol MRPL58
Protein Name mitochondrial ribosomal protein L58
Synonyms DS-1|DS1|ICT1|MRP-L58
Ortholog resource in our bank

  MRPL58

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011013 IRAK027I21 pCMV-SPORT6 BC015335 NM_001545 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180956 ARi52G12 pGCAP10 NM_001545.1  
GAAGACCTGAGCATGGCGGCCACCAGGAGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTC
HKR238464 ARiS096C16 pGCAP10 NM_001545.1  
GAGACCTGAGCATGGCGGCCACCAGGTGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTCT
HKR399380 RBd98H12 pGCAP10 NM_001545.1  
GACCTGAGCATGGCGGCCACCAGGTGCCTGCGCTGGGGCCTGAGCCGAGCCGGAGTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl