Prev. |  KEGG KO K09507 > 

RIKEN DNA Bank Human Resource - DNAJB1

Gene ID NCBI Gene 3337 |  KEGG hsa:3337
Gene Symbol DNAJB1
Protein Name DnaJ heat shock protein family (Hsp40) member B1
Synonyms HSPF1|Hdj1|Hsp40|RSPH16B|Sis1
Featured content Influenza A relevant genes - human
Ortholog resource in our bank

  DNAJB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02440 Human Hsp40 genomic clone pB#4-X Containing complete coding sequence and promoter region of Human Hsp40 gene

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016809 IRAK042A09 pCMV-SPORT6 BC019827 NM_006145 Full
HGY080504 IRAL001E08 pOTB7 BC002352 NM_006145 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219936 ARiS049N24 pGCAP10 NM_006145.1  
GAGCCGGGGGACGGCGACAGCGGGTCGGCGGGCCGCAGGAGGGGGTCATGGGTAAAGACT
HKR235140 ARiS087O04 pGCAP10 NM_006145.1  
GGGGGTAAGAAGTTGAGTGACAGGCAAGGCAGCATCCACATGACAGGCGGCGCCGAAGGG
HKR279339 ARiS198F19 pGCAP10 NM_006145.1  
GGGGtgGGGgagcCgGGGgTgacGacgGGGacgGCGCGGCGGAgCCCGCTGCGGACCCGG
HKR368126 RBd20F06 pGCAP10 NM_006145.1  
GGGGTATATAGAGTCCGGGACTGGTCGGCGGCGGAGCCGGGGGACGGCGACAGCGGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.17

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl