Prev. |  KEGG KO K04078 > 

RIKEN DNA Bank Human Resource - HSPE1

Gene ID NCBI Gene 3336 |  KEGG hsa:3336
Gene Symbol HSPE1
Protein Name heat shock protein family E (Hsp10) member 1
Synonyms CPN10|EPF|GROES|HSP10
Ortholog resources KEGG ortholog (KEGG orthology K04078) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087183 IRAL017P23 pOTB7 BC023518 NM_002157 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045369 ARe13H01 pKA1U5 NM_002157.2  
GGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAG
HKR048883 ARe22D11 pKA1U5 NM_002157.2  
GGGGTGATTTTTTCACGTGTCGCCAGGGCCGGACTGCGAGTCTCTTTGCGGCGCTACACT
HKR056552 ARe41G08 pKA1U5 NM_002157.2  
ATCCTGGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGG
HKR069655 ARe74C07 pKA1U5 NM_002157.2  
GGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGCTACGAGTCTGAGGCGGAGGGAGTAAT
HKR076036 ARe90B12 pKA1U5 NM_002157.2  
GGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAA
HKR166035 ARi15B11 pGCAP10 NM_002157.2  
GGCCAGGGCCGGACTGCGAGTCTCTTTGCGGCGCTACACTAGAGCANNGTACGAGTCTGA
HKR166411 ARi16A11 pGCAP10 NM_002157.2  
GGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATG
HKR168409 ARi21A09 pGCAP10 NM_002157.2  
GGGGCTAGCGGCGACGGCTGGGGCGAGCGCGCCTGCGCGCTGGGTGATTTTTTCACGTGT
HKR176429 ARi41B05 pGCAP10 NM_002157.2  
GGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAA
HKR184053 ARi60C05 pGCAP10 NM_002157.2  
GACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAA
HKR185231 ARi63B07 pGCAP10 NM_002157.2  
TGGGGNGNTTTTTTCACGTGNCGCCAGGGCCGGACTGCGAGTCTCTTTGCGGCGCTACCC
HKR234825 ARiS087B01 pGCAP10 NM_002157.2  
HKR247570 ARiS118P10 pGCAP10 NM_002157.2  
GGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTT
HKR279327 ARiS198F07 pGCAP10 NM_002157.2  
GAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTT
HKR321205 RBb03A05 pKA1U5 NM_002157.2  
GGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAA
HKR341332 RBb53F12 pGCAP1 NM_002157.2  
GAGACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGA
HKR344929 RBb62F09 pGCAP1 NM_002157.2  
HKR362971 RBd07H03 pGCAP10 NM_002157.2  
GAGCGGCGACGGCTGGGGCGAGCGCGCCTGCGCGCTGGGTGATTTTTTCACGTGTCGCCA
HKR364500 RBd11E04 pGCAP10 NM_002157.2  
GACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGA
HKR368151 RBd20G07 pGCAP10 NM_002157.2  
GGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAG
HKR369348 RBd23G04 pGCAP10 NM_002157.2  
GAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTTTCTTC
HKR375374 RBd38H06 pGCAP10 NM_002157.2  
GAGACCGCAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTT
HKR375730 RBd39F10 pGCAP10 NM_002157.2  
GACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAA
HKR377278 RBd43D06 pGCAP10 NM_002157.2  
GGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAG
HKR396101 RBd90E05 pGCAP10 NM_002157.2  
TGGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTA
HKR405965 RBdS014P05 pGCAP10 NM_002157.2  
CGGANTCTCTTTGCGGCGCTACACTAGAGCANANTANGAGTCTGAGGCGGAGGGAGTAAT
HKR406025 RBdS015B01 pGCAP10 NM_002157.2  
GACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAA
HKR406100 RBdS015E04 pGCAP10 NM_002157.2  
GGGGTGATTTTTTCACGTGTCGCCAGGGCCGGACTGCGAGTCTCTTTGCGGCGCTACACT
HKR444103 RBdS110E07 pGCAP10 NM_002157.2  
GGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAA
HKR452964 RBdS132G20 pGCAP10 NM_002157.2  
GGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAA
HKR462452 RBdS156C04 pGCAP10 NM_002157.2  
GACGTGTCGCCAGGGCCGGACTGCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl