Prev. |  KEGG KO K04079 > 

RIKEN DNA Bank Human Resource - HSP90AB1

Gene ID NCBI Gene 3326 |  KEGG hsa:3326
Gene Symbol HSP90AB1
Protein Name heat shock protein 90 alpha family class B member 1
Synonyms D6S182|HSP84|HSP90B|HSPC2|HSPCB
Ortholog resource in our bank

  HSP90AB1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07321 pGL4-phHSP90AB1(HSPCB) Promoter collection, Human HSP90AB1 promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY066928 IRAK167F08 pBluescriptR BC068474 NM_007355 Full
HGY081427 IRAL003J11 pOTB7 BC016753 NM_007355 Full
HGY084611 IRAL011I19 pOTB7 BC012807 NM_007355 Full
HGY093880 IRAL034L16 pOTB7 BC014485 NM_007355 Full
HGY089606 IRAL024A06 pOTB7 BC007327 NM_007355 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081601 M01C004A01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081649 M01C004C01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081697 M01C004E01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081745 M01C004G01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081793 M01C004I01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081841 M01C004K01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081889 M01C004M01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE081937 M01C004O01 pDONR221 04-134-2_2-E01 BC016753 ENST00000343988  
HGE110431 M01C076B07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110479 M01C076D07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110527 M01C076F07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110575 M01C076H07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110623 M01C076J07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110671 M01C076L07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110719 M01C076N07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE110767 M01C076P07 pDONR221 06-2_01-G04 BC016753 ENST00000343988  
HGE100003 M01C050A03 pDONR221 MGC14-E02 BC016753 ENST00000343988  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE030238 W01A075J22 pENTR-TOPO IRAK167F08 BC068474 NM_007355  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041230 ARe03B06 pKA1U5 NM_007355.2  
ATCCTGCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGC
HKR049674 ARe24D02 pKA1U5 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGCTCTGGGTATCGGAAAGCAAGCCTAC
HKR050925 ARe27F05 pKA1U5 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGCCTGTCTGGGTATCGGAAAGCAAGCCTA
HKR058169 ARe45H01 pKA1U5 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR059356 ARe48G12 pKA1U5 NM_007355.2  
GCTCGAGTCACTCCGGCGCAGTGTTGGGACTGCTCTGGGTATCGGAAAGCAAGCCTACGT
HKR060450 ARe51C02 pKA1U5 NM_007355.2  
ATCCTGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAA
HKR061680 ARe54D08 pKA1U5 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGCTCTGGGTATCGGAAAGCAAGCCTAC
HKR064932 ARe62F12 pKA1U5 NM_007355.2  
GACGCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCT
HKR070835 ARe77B11 pKA1U5 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACNGCTNTGGGTATCGGAAAGCAAGCCTAC
HKR070875 ARe77D03 pKA1U5 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGNTCTGGGTATCGGAAAGCAAGCCTAC
HKR071657 ARe79C09 pKA1U5 NM_007355.2  
GTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACGT
HKR080948 ARf02G04 pKA1U5 NM_007355.2  
GGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACGTTGCTCACTATTACGTAT
HKR171727 ARi29F07 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR174857 ARi37C09 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR203291 ARiS008D19 pGCAP10 NM_007355.2  
GTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACGT
HKR238527 ARiS096F07 pGCAP10 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTA
HKR322502 RBb06E06 pKA1U5 NM_007355.2  
TCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGCTCTGGGTATCGGAAAGCAAGCCTAC
HKR326004 RBb15A04 pKA1U5 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTTCTGGGTATCGGAAAGCAAGCCT
HKR332873 RBb32D01 pGCAP1 NM_007355.2  
GACGGCCACCATCTTTCTTGGGTTTGGTCCTGTTCTGTAATTTTGTGCTGTGAAAGGGTC
HKR343372 RBb58H04 pGCAP1 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGNTGATTGGGACTGTCTGGNCTATCGGAAAGCAAGCCT
HKR361253 RBd03C05 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR363632 RBd09B08 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR365301 RBd13E05 pGCAP10 NM_007355.2  
GAGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCC
HKR373769 RBd34H01 pGCAP10 NM_007355.2  
CGGCCGGCCGATAGAGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTAT
HKR374030 RBd35B06 pGCAP10 NM_007355.2  
ATGTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR374883 RBd37D11 pGCAP10 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTA
HKR378123 RBd45F03 pGCAP10 NM_007355.2  
GAGTAGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAA
HKR380131 RBd50F11 pGCAP10 NM_007355.2  
CGGCCGGCCGATGTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGA
HKR380850 RBd52C02 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR381327 RBd53F07 pGCAP10 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTA
HKR385377 RBd63H09 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR392426 RBd81B02 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR393210 RBd83A10 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR393652 RBd84C04 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR395276 RBd88D04 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR395679 RBd89D07 pGCAP10 NM_007355.2  
GCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGATGCAAGCCTAC
HKR397605 RBd94A05 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR402873 RBdS007D01 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR405395 RBdS013I03 pGCAP10 NM_007355.2  
AGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCT
HKR441648 RBdS104B24 pGCAP10 NM_007355.2  
GNNCCGGNCTATNTCCNGTGNNNNGNCGGNANTGGATNGCCCTTTAANGNGGNNNAANTG
HKR441669 RBdS104C21 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR441795 RBdS104I03 pGCAP10 NM_007355.2  
GCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTACG
HKR444318 RBdS110N06 pGCAP10 NM_007355.2  
GTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCCTAC
HKR471005 RBdS177I13 pGCAP10 NM_007355.2  
GAGCTCTCTCGAGTCACTCCGGCGCAGTGTTGGGACTGTCTGGGTATCGGAAAGCAAGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl