Prev. |  KEGG KO K04079 > 

RIKEN DNA Bank Human Resource - HSP90AA1

Gene ID NCBI Gene 3320 |  KEGG hsa:3320
Gene Symbol HSP90AA1
Protein Name heat shock protein 90 alpha family class A member 1
Synonyms EL52|HEL-S-65p|HSP86|HSP89A|HSP90A|HSP90N|HSPC1|HSPCA|HSPCAL1|HSPCAL4|HSPN|Hsp103|Hsp89|Hsp90|LAP-2|LAP2
Ortholog resources KEGG ortholog (KEGG orthology K04079) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01127 pHSP90 Human hsp 90 alpha cDNA
RDB01135 Cosmid clone HSPCAL4, HSP90 alpha family Human HSP90alpha cosmid DNA (HSPCAL4)
RDB04837 SEREX clone NGO-Pr-149 (ID 2490) #1 SEREX clone NGO-Pr-149 (ID 2490) #1
RDB05927 pAxCALNLhhsp90 (forward) Shuttle vector to generate rAd harboring human hsp90 (forward)

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001210 IRAK003A10 pCMV-SPORT6 BC000987 NM_005348 Partial
HGY081438 IRAL003J22 pOTB7 BC001695 NM_005348
HGY084092 IRAL010D20 pOTB7 BC007989 NM_005348 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050577 ARe26H09 pKA1U5 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCCTTNGATCCTGTGCGGTCACTTAGCCAA
HKR053606 ARe34A06 pKA1U5 NM_005348.3  
GGTCGCTATATAAGGCAGGCGCGGGGGTGGCGCGTCAGTTGCTTCAGCGTCCCGGTGTGG
HKR057253 ARe43C05 pKA1U5 NM_005348.3  
GAGTTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGCTTGGTCCTGTGCGGTCACTTAGCCA
HKR080928 ARf02F08 pKA1U5 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR182176 ARi55H08 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR184409 ARi61A09 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR188100 ARi70E04 pGCAP10 NM_005348.3  
GGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAGATGC
HKR276459 ARiS191C11 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR328547 RBb21G03 pKA1U5 NM_005348.3  
HKR334173 RBb35H05 pGCAP1 NM_005348.3  
AGTTGCTTCAGCGCTCCCGGTGTGGCTGTGCCGTTTGGTCCTGTGCGGTCACTTAGCCAA
HKR337727 RBb44F07 pGCAP1 NM_005348.3  
TTGAAGTTGCTTCAGCGCTCCCGGTGTGGCTGTGCCGTTGGTCCTGATGCGGTCACTTAG
HKR362453 RBd06C05 pGCAP10 NM_005348.3  
TGAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAA
HKR362883 RBd07D11 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR363679 RBd09D07 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR373273 RBd33D01 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR384147 RBd60G03 pGCAP10 NM_005348.3  
GCCCTGTGCGGTCACTTAGCCAAGATGCCTGAGGAAACCCAGACCCAAGACCAACCGATG
HKR388853 RBd72C05 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR389307 RBd73E11 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR396554 RBd91G10 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR397308 RBd93E12 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR402951 RBdS007G07 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR405770 RBdS014H02 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR405868 RBdS014L04 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR405893 RBdS014M05 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR406120 RBdS015E24 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR428142 RBdS070F22 pGCAP10 NM_005348.3  
GGTCGCTATATAAGGCAGGCGCGGGGGTGGCGCGTCAGTTGCTTCAGCGTCCCGGTGTGG
HKR432600 RBdS081I08 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR433204 RBdS083A04 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR433353 RBdS083G09 pGCAP10 NM_005348.3  
GAGTTGCTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG
HKR462612 RBdS156I20 pGCAP10 NM_005348.3  
GAGTTNNTTCAGCGTCCCGGTGTGGCTGTGCCGTTGGTCCTGTGCGGTCACTTAGCCAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl