Prev. |  KEGG KO K09543 > 

RIKEN DNA Bank Human Resource - HSPB2

Gene ID NCBI Gene 3316 |  KEGG hsa:3316
Gene Symbol HSPB2
Protein Name heat shock protein family B (small) member 2
Synonyms HSP27|Hs.78846|LOH11CR1K|MKBP
Ortholog resources KEGG ortholog (KEGG orthology K09543) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR075636 ARe89B12 pKA1U5 NM_001541.2  
GCTCCTATCGAGCCCTGGCTCTCCGGGCAGCTGGAGGGGTCGCGCTGCGCCTGTTGGGGC
HKR082054 ARf05C06 pKA1U5 NM_001541.2  
GGCGCCTGTTGGGGCTGCACCTCGGACCAGGGCTTCTGCTGCATCTGCAGCCATGTCGGG
HKR234933 ARiS087F13 pGCAP10 NM_001541.2  
GGCCAACCCNAGCCGCCNGGGTGANCANCGCTTCGGAGAAGGCCTCCTGCCAGAAGAGAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl