Prev. |  KEGG KO K09490 > 

RIKEN DNA Bank Human Resource - HSPA5

Gene ID NCBI Gene 3309 |  KEGG hsa:3309
Gene Symbol HSPA5
Protein Name heat shock protein family A (Hsp70) member 5
Synonyms BIP|GRP78|HEL-S-89n|MIF2
Ortholog resource in our bank

  HSPA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081606 M01C004A06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081654 M01C004C06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081702 M01C004E06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081750 M01C004G06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081798 M01C004I06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081846 M01C004K06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081894 M01C004M06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  
HGE081942 M01C004O06 pDONR221 04-134-2_2-F03 BC020235 NM_005347  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR056410 ARe41A10 pKA1U5 NM_005347.3  
GGACGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR057756 ARe44G12 pKA1U5 NM_005347.3 done
GGACGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR167325 ARi18F05 pGCAP10 NM_005347.3  
GGACGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR180126 ARi50F06 pGCAP10 NM_005347.3  
GGACGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR184556 ARi61G12 pGCAP10 NM_005347.3 done
GGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGAGGG
HKR205547 ARiS013O11 pGCAP10 NM_005347.3  
GGACGCCNGCCAANACNGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR219653 ARiS049C05 pGCAP10 NM_005347.3 done
TGGACGCCGGCCAAGACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAG
HKR234115 ARiS085E19 pGCAP10 NM_005347.3  
GGACGCCGGCCAANACAGCACAGACAGATTGACCTATTGGGGTGTTTCGCGAGTGTGAGA
HKR260304 ARiS150M16 pGCAP10 NM_005347.3  
GAAGACNGCACAGACNNNTTGACCTATTGGGGTGTTTCGCGAGTGTGAGAGGGAAGCGCC
HKR260352 ARiS150O16 pGCAP10 NM_005347.3  
GNNGACNNNNCAGACANATNNNCCTATTGGGGTGTTTCTCGAGTGTGANAGGGAANCGCC
HKR408983 RBdS022H15 pGCAP10 NM_005347.3  
GGACGCCNGNNAANACNNCACANACAGATTGACCTATTGGGGTGTTTCGANAGTGTNANA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl