Prev. |  KEGG KO K09489 > 

RIKEN DNA Bank Human Resource - HSPA4

Gene ID NCBI Gene 3308 |  KEGG hsa:3308
Gene Symbol HSPA4
Protein Name heat shock protein family A (Hsp70) member 4
Synonyms APG-2|HEL-S-5a|HS24/P52|HSPH2|RY|hsp70|hsp70RY
Ortholog resource in our bank

  HSPA4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04562 SEREX clone NGO-Br-43 (ID 1275) #1 SEREX clone NGO-Br-43 (ID 1275) #1
RDB15748 CMV:HSP70-mCherry Expression vector of human Hsp70.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276490 ARiS191D18 pGCAP10 NM_002154.3  
GGAAATTTTTCNAGATCTTCTCCGCCCCCGCTACCGGCGCCTCCTCTGCGGCCACTGAGC
HKR391258 RBd78C10 pGCAP10 NM_002154.3  
CGGCCGGCCGATGGAGATCTTCTCCGCCCCCGCTACCGGCGCCTCCTCTGCGGCCACTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.12.13

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl