Prev. |  KEGG KO K03283 > 

RIKEN DNA Bank Human Resource - HSPA1A

Gene ID NCBI Gene 3303 |  KEGG hsa:3303
Gene Symbol HSPA1A
Protein Name heat shock protein family A (Hsp70) member 1A
Synonyms HEL-S-103|HSP70-1|HSP70-1A|HSP70-2|HSP70.1|HSP70.2|HSP70I|HSP72|HSPA1
Featured content Endocytosis (human)
Ortholog resource in our bank

  HSPA1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05541 pKM2L-phHSP701 Promoter Bank clone, Human 72-kDa heat shock protein (HSP70-1) promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082095 IRAL005D23 pOTB7 BC002453 NM_005345 Full/var
HGY090510 IRAL026E14 pOTB7 BC009322 NM_005345 Full/var
HGY096343 IRAL040O07 pOTB7 BC018740 NM_005345 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097215 M01C043A15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097263 M01C043C15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097311 M01C043E15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097359 M01C043G15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097407 M01C043I15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097455 M01C043K15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097503 M01C043M15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097551 M01C043O15 pDONR221 MGC11-A08 BC002453 NM_005345  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR243656 ARiS109C08 pGCAP10 NM_005345.5  
GAACGGCTAGCCTGAGGAGCTGCTGCGACAGTCCACTACCTTTTTCGAGAGTGACTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl