Prev. | Human A to Z list > H > 

RIKEN DNA Bank Human Resource - HSPA1A

Gene ID (NCBI) 3303
Gene Symbol HSPA1A
Protein Name heat shock 70kDa protein 1A
Synonyms HSP70-1|HSP70-1A|HSP70I|HSP72|HSPA1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05541 pKM2L-phHSP701 Promoter Bank clone, Human 72-kDa heat shock protein (HSP70-1) promoter

RDB_hum_161122.csv


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY082095 IRAL005D23 pOTB7 BC002453 NM_005345 Full/var
HGY090510 IRAL026E14 pOTB7 BC009322 NM_005345 Full/var
HGY096343 IRAL040O07 pOTB7 BC018740 NM_005345 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE097215 M01C043A15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097263 M01C043C15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097311 M01C043E15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097359 M01C043G15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097407 M01C043I15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097455 M01C043K15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097503 M01C043M15 pDONR221 MGC11-A08 BC002453 NM_005345  
HGE097551 M01C043O15 pDONR221 MGC11-A08 BC002453 NM_005345  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR243656 ARiS109C08 pGCAP10 NM_005345.5  
GAACGGCTAGCCTGAGGAGCTGCTGCGACAGTCCACTACCTTTTTCGAGAGTGACTCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.02.09

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl