Prev. |  KEGG KO K09508 > 

RIKEN DNA Bank Human Resource - DNAJB2

Gene ID NCBI Gene 3300 |  KEGG hsa:3300
Gene Symbol DNAJB2
Protein Name DnaJ heat shock protein family (Hsp40) member B2
Synonyms CMT2T|DSMA5|HSJ-1|HSJ1|HSPF3
Ortholog resource in our bank

  DNAJB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019474 IRAK048L10 pBluescriptR BC040494 NM_006736 Partial/var
HGX020118 IRAK050E22 pCMV-SPORT6 BC047056 NM_001039550 Full
HGY084987 IRAL012H19 pOTB7 BC011609 NM_006736 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE031724 W01A079F04 pENTR-TOPO IRAL012H19 BC011609 NM_006736  
HGE031732 W01A079F12 pENTR-TOPO IRAL012H19 BC011609 NM_006736  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050451 ARe26C03 pKA1U5 NM_006736.5  
GGCTGACGCATGCCTGCGCGCACAGCTGGGCCGGGCGCGTCCTACGCAGCAGCCGCGAGC
HKR173371 ARi33H03 pGCAP10 NM_006736.5  
GAGGTGCGGCCGGGGGCCCGGGTCAGGCTGGGGGCCCTGGATCGGACTGCTGGAGTTGGG
HKR276666 ARiS191L02 pGCAP10 NM_006736.5  
CGGCCGGCCGATGGGTTCCCGGCGGGGGGCAGGGGCGGGGCGCCGCAGGAGGCCGGGACT
HKR277869 ARiS194L05 pGCAP10 NM_006736.5  
GGCGCCNCAGGAGGCCGGGACTCCTGGCGGAGGAGCCCCAAGGAGGCCCGCCTGACGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl