Prev. |  KEGG KO K13368 > 

RIKEN DNA Bank Human Resource - HSD17B2

Gene ID NCBI Gene 3294 |  KEGG hsa:3294
Gene Symbol HSD17B2
Protein Name hydroxysteroid 17-beta dehydrogenase 2
Synonyms EDH17B2|HSD17|SDR9C2
Ortholog resources KEGG ortholog (KEGG orthology K13368) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088419 IRAL021A19 pDNR-LIB BC009581 NM_002153 Full
HGY088755 IRAL021O19 pDNR-LIB BC059170 NM_002153 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE029288 W01A073D16 pENTR-TOPO IRAL021A19 BC009581 NM_002153  
HGE029290 W01A073D18 pENTR-TOPO IRAL021A19 BC009581 NM_002153  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046829 ARe17B05 pKA1U5 NM_002153.1  
GAGAAAAAGGACTCAGCACCCAGACATACTGCAGGCTCTTGAAGAAGACAGTATTTTCCT
HKR065656 ARe64C08 pKA1U5 NM_002153.1  
GGCACACTGGNTTTAAATTACCCACTGGGAATATGATTATGCTTAATCTATGCTCAGTCG
HKR166056 ARi15C08 pGCAP10 NM_002153.1  
GGCTTAATCTATGCTCAGTTGAAAGGGGCTGGGGCTGCTTTCTCCCCTCCCTTCTTGACT
HKR235048 ARiS087K08 pGCAP10 NM_002153.1  
GGCTTTCTCCCCTCCCTTCTTGACTCTCTGTTCACAGAACTCAGGCTGCCTCCAGCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl