Prev. |  KEGG KO K19765 > 

RIKEN DNA Bank Human Resource - HSBP1

Gene ID NCBI Gene 3281 |  KEGG hsa:3281
Gene Symbol HSBP1
Protein Name heat shock factor binding protein 1
Synonyms NPC-A-13
Ortholog resource in our bank

  HSBP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084118 IRAL010E22 pOTB7 BC007515 NM_001537 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044050 ARe10C02 pKA1U5 NM_001537.2  
GACGGTCTGAGACATCACCGCCAAGCTGGGCATCGGGGAGATGGCCGAGACTGACCCCAA
HKR075658 ARe89C10 pKA1U5 NM_001537.2  
GAGCGGCCCGGGGCGACTGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCAC
HKR178850 ARi47C02 pGCAP10 NM_001537.2  
GGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCGGGGA
HKR235009 ARiS087I17 pGCAP10 NM_001537.2  
GANACNGAANTGTAGGTNNNNNTCTGAGACATCACCGCCAAGCTGGGCATCGGGGAGATG
HKR276443 ARiS191B19 pGCAP10 NM_001537.2  
GAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCGGGGAGATGGCCGAGACTGAC
HKR333658 RBb34C10 pGCAP1 NM_001537.2  
GGACTGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGC
HKR341205 RBb53A05 pGCAP1 NM_001537.2  
GGCAGCGGCCCGGGGCGACTGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATC
HKR369325 RBd23F05 pGCAP10 NM_001537.2  
GAGCGGCCCGGGGCGACTGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCAC
HKR387745 RBd69G01 pGCAP10 NM_001537.2  
GAGCGGCCCGGGGCGACTGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCAC
HKR392455 RBd81C07 pGCAP10 NM_001537.2  
GAGTCTCGTCGCGAGAAGCAGCGGCCCGGGGCGACTGAGCGGACAAACGGAAGTGTAGGT
HKR392552 RBd81G08 pGCAP10 NM_001537.2 done
GGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCG
HKR392836 RBd82B12 pGCAP10 NM_001537.2  
GGAGCGGACAAACGGAAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCG
HKR433554 RBdS083O18 pGCAP10 NM_001537.2  
GGAGCTGCCAGTCTCGTCGCGAGAAGCAGCGGCCCGGGGCGACTGAGCGGACAAACGGAA
HKR453029 RBdS132J13 pGCAP10 NM_001537.2  
GGAACAAACGGAAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCGGGGA
HKR475178 RBdS187P18 pGCAP10 NM_001537.2  
CGGCCGGCCGATGAGTGTAGGTTACGGTCTGAGACATCACCGCCAAGCTGGGCATCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl