Prev. |  KEGG KO K20193 > 

RIKEN DNA Bank Human Resource - HPS1

Gene ID NCBI Gene 3257 |  KEGG hsa:3257
Gene Symbol HPS1
Protein Name HPS1, biogenesis of lysosomal organelles complex 3 subunit 1
Synonyms BLOC3S1|HPS
Ortholog resources KEGG ortholog (KEGG orthology K20193) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081614 IRAL004A14 pOTB7 BC002514 NM_182637 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR063779 ARe59H11 pKA1U5 NM_000195.2  
GAAGCGCGCCCGGGCTCCTGCAGGCGGGGCGCTGTGCGCGCCGCGATCCGCATTTGCAGG
HKR183283 ARi58D11 pGCAP10 NM_000195.2  
GGCGCGCCCGGGCTCCTGCAGGCGGNCGCTGTGCGCGCCGCGATCCGGTACGTGGCNTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl