Prev. |  KEGG KO K00760 > 

RIKEN DNA Bank Human Resource - HPRT1

Gene ID NCBI Gene 3251 |  KEGG hsa:3251
Gene Symbol HPRT1
Protein Name hypoxanthine phosphoribosyltransferase 1
Synonyms HGPRT|HPRT
Ortholog resources KEGG ortholog (KEGG orthology K00760) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082307 IRAL005M19 pOTB7 BC000578 NM_000194 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR185683 ARi64D11 pGCAP10 NM_000194.2  
HKR186460 ARi66C12 pGCAP10 NM_000194.2  
GGCTTCTCCTCAGCTTCAGGCGGCTGCGACGAGCCCTCAGGCGAACCTCTCGGCTTTCCC
HKR247407 ARiS118I15 pGCAP10 NM_000194.2  
GGAACCTCTCGGCTTTCCCGCGCGGCGCCGCCTCTTGCTGCGCCTCCGCCTCCTCCTCTG
HKR328549 RBb21G05 pKA1U5 NM_000194.2  
GAGGCGGCTGCGACGAGCCCTCAGGCGAACCTCTCGGCTTTCCCGCGCGGCGCCGCCTCT
HKR348436 RBb71B12 pGCAP1 NM_000194.2  
GAGGCGAACCTCTCGGCTTTCCCGCGCGGCGCCGCCTCTTGCTGCGCCTCCGCCTCCTCC
HKR405524 RBdS013N12 pGCAP10 NM_000194.2  
GGCCACCGGCTTCCTCCTCCTGAGCAGTCAGCCCGCGCGCCGGCCGGCTCCGTTATGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl