Prev. |  KEGG KO K00457 > 

RIKEN DNA Bank Human Resource - HPD

Gene ID NCBI Gene 3242 |  KEGG hsa:3242
Gene Symbol HPD
Protein Name 4-hydroxyphenylpyruvate dioxygenase
Synonyms 4-HPPD|4HPPD|GLOD3|HPPDASE|PPD
Ortholog resources KEGG ortholog (KEGG orthology K00457) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097106 IRAL042M18 pOTB7 BC024287 NM_002150 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082802 ARf07A02 pKA1U5 NM_002150.2  
GCTCTACTCCCAGCTAGGTAGGTTTGACGTAACGATCANTCATGCACNAACTTACNGNTG
HKR166402 ARi16A02 pGCAP10 NM_002150.2  
GCTCTAGTCCCAGTAGGAGGTTTGACTAAGATCAATCATGACGACTTACAGTGACAAAGG
HKR235539 ARiS088O03 pGCAP10 NM_002150.2  
GCTCTAGTCCCAGTAGGAGGTTTGACTAAGATCAATCATGACGACTTACAGTGACAAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl