Prev. | 

RIKEN DNA Bank Human Resource - HPCAL1

Gene ID NCBI Gene 3241 |  KEGG hsa:3241
Gene Symbol HPCAL1
Protein Name hippocalcin like 1
Synonyms BDR1|HLP2|VILIP-3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008946 IRAK022G02 pCMV-SPORT6 BC017028 NM_134421 Full
HGY089269 IRAL023C21 pOTB7 BC017482 NM_134421 Full
HGY090362 IRAL025P02 pOTB7 BC009846 NM_134421 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028442 W01A071B18 pENTR-TOPO flj0059f09 AK000596 NM_134421  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044428 ARe11B04 pKA1U5 NM_002149.2  
GCTTCCCGGAGCTGGCAGGCGGGCCGCGGCGGCGGCGGGCAGCGGACGGGCGGACTGACG
HKR168576 ARi21H08 pGCAP10 NM_002149.2  
GCTTCCCGGAGCTGGCAGGCGGGCCGCGGCGGCGGCGGGCAGCGGACGGGCGGACTGACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl