Prev. |  KEGG KO K12888 > 

RIKEN DNA Bank Human Resource - HNRNPU

Gene ID NCBI Gene 3192 |  KEGG hsa:3192
Gene Symbol HNRNPU
Protein Name heterogeneous nuclear ribonucleoprotein U
Synonyms EIEE54|HNRNPU-AS1|HNRPU|SAF-A|SAFA|U21.1|hnRNP U|pp120
Ortholog resources KEGG ortholog (KEGG orthology K12888) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001503 IRAK003M15 pCMV-SPORT6 BC003367 NM_004501 Full
HGX017026 IRAK042J10 pCMV-SPORT6 BC024767 NM_004501 Full
HGY081207 IRAL003A07 pOTB7 BC003621 NM_004501 Full
HGY088272 IRAL020L08 pOTB7 BC007950 NM_004501 Partial/var
HGY093705 IRAL034E09 pOTB7 BC015782 NM_031844 Partial
HGY097262 IRAL043C14 pOTB7 BC034925 NM_031844 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR073203 ARe83A03 pKA1U5 NM_004501.3  
GGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGAACCCATCTC
HKR322009 RBb05A09 pKA1U5 NM_004501.3  
GAGGCGAGTCTCCGCGTCTCCCTCGCGAACTCGGTGAAAGGAATTGGCGCCGTTCGACAC
HKR368521 RBd21F01 pGCAP10 NM_004501.3  
GGGATCCGCTCTGCAGCACGAACCCATCTCCAGCCGCAGCCGCAGCCGCCGCCCGGGCCG
HKR387729 RBd69F09 pGCAP10 NM_004501.3  
GGCTCCTGCGAGAGGACGTTGCGTGCTCGCTCGCGCCAGGCGAGTCTCCGCGTCTCCCTC
HKR392130 RBd80F10 pGCAP10 NM_004501.3  
GGCTCCTGCGAGAGGACGTTGCGTGCTCGCTCGCGCCAGGCGAGTCTCCGCGTCTCCCTC
HKR394057 RBd85C09 pGCAP10 NM_004501.3  
GCNNNNCCNGGCGGATCCGNTCTGCNGCACNAACCCNTCTCCNGCCNCANNCGCNGCCGC
HKR394974 RBd87H06 pGCAP10 NM_004501.3  
GGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGAACCCATCTC
HKR396057 RBd90C09 pGCAP10 NM_004501.3  
GCTCCGCGTCTCCCTCGCGAACTCGGTGAAAGGAATTGGCGCCGTTCGACACCAGGCGGA
HKR396929 RBd92F09 pGCAP10 NM_004501.3  
GGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGAACCCATCTC
HKR397325 RBd93F05 pGCAP10 NM_004501.3  
GACCAGGCGGATCCGCTCTGCAGCACGAACCCATCTCCAGCCGCAGCCGCAGCCGCCGCC
HKR398104 RBd95E08 pGCAP10 NM_004501.3  
GGAACTCGGTGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGA
HKR405715 RBdS014E19 pGCAP10 NM_004501.3  
GGAACTCGGTGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGA
HKR406282 RBdS015L18 pGCAP10 NM_004501.3  
GGCTCCTGCGAGAGGACGTTGCGTGCTCGCTCGCGCCAGGCGAGTCTCCGCGTCTCCCTC
HKR416048 RBdS040B24 pGCAP10 NM_004501.3  
GAATATGTCAATATAAGTACAATGTTGAATTCAAACAATCTGTTGAATTAAATTCTGTTG
HKR432658 RBdS081K18 pGCAP10 NM_004501.3  
GGAGAGGACGTTGCGTGCTCGCTCGCGCCAGGCGAGTCTCCGCGTCTCCCTCGCGAACTC
HKR432777 RBdS081P17 pGCAP10 NM_004501.3  
GGACGTTGCGTGCTCNCTCGCGCCAGGCGAGTCTCCGCGTCTCCCTCGCGAACTCGGTGA
HKR453056 RBdS132K16 pGCAP10 NM_004501.3  
GGGTGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGAACCCAT
HKR462633 RBdS156J17 pGCAP10 NM_004501.3  
GTCTCCNCGTCTCCCTCGCGAACTCGGTGAAAGGAATTGGCGCCGTTCGACACCAGGCGG
HKR471093 RBdS177M05 pGCAP10 NM_004501.3  
GGAAAGGAATTGGCGCCGTTCGACACCAGGCGGATCCGCTCTGCAGCACGAACCCATCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl