Prev. |  KEGG KO K13159 > 

RIKEN DNA Bank Human Resource - HNRNPL

Gene ID NCBI Gene 3191 |  KEGG hsa:3191
Gene Symbol HNRNPL
Protein Name heterogeneous nuclear ribonucleoprotein L
Synonyms HNRPL|P/OKcl.14|hnRNP-L
Ortholog resources KEGG ortholog (KEGG orthology K13159) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056405 IRAK141A05 pCMV-SPORT6 BC069184 NM_001005335 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR174098 ARi35E02 pGCAP10 NM_001005335.1  
GGGAGAAGCGGCGTCGGCGGCTGGAGCAGAGGCAGCAGCCGGACGAGCAGCGGAGGCGGT
HKR222352 ARiS055O16 pGCAP10 NM_001005335.1  
GGGAGAAGCGGCGTCGGCGGCTGGAGCAGAGGCAGCAGCCGGACGAGCAGCGGAGGCGGT
HKR362180 RBd05H12 pGCAP10 NM_001005335.1  
GAAGCGGCGTCGGCGGCTGGAGCAGAGGCAGCAGCCGGACGAGCAGCGGAGGCGGTCGGG
HKR381202 RBd53A02 pGCAP10 NM_001005335.1  
GANNNNCGNCTNCNGGGNNTGGAGNAGAGGCATCACCCGGNCNANNNNCGNANGNGGNNN
HKR384454 RBd61C06 pGCAP10 NM_001005335.1  
GGGAGAAGCGGCGTCGGCGGCTGGAGCAGAGGCAGCAGCCGGACGAGCAGCGGAGGCGGT
HKR384955 RBd62G11 pGCAP10 NM_001005335.1  
GAAGCGGCGTCGGCGGCTGGAGCAGAGGCAGCAGCCGGACGAGCAGCGGAGGCGGTCGGG
HKR389373 RBd73H05 pGCAP10 NM_001005335.1  
GGCCGCCTTNNCGNGGAGGCTGCTGCCCCGGGCGGAGAAGCGGCGTCGGCGGCTGGAGCA
HKR428269 RBdS070L05 pGCAP10 NM_001005335.1  
GGGAGGCGGTCGGGAGCGATGGTGAAGATGGCGGCGGCGGGCGGCGGAGGCGGCGGTGGC
HKR432522 RBdS081F02 pGCAP10 NM_001005335.1  
GGGAGGCGGTCGGGAGCGATGGTGAAGATGGCGGCGGCGGGCGGCGGAGGCGGCGGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl