Prev. |  KEGG KO K12886 > 

RIKEN DNA Bank Human Resource - HNRNPK

Gene ID NCBI Gene 3190 |  KEGG hsa:3190
Gene Symbol HNRNPK
Protein Name heterogeneous nuclear ribonucleoprotein K
Synonyms AUKS|CSBP|HNRPK|TUNP
Ortholog resources KEGG ortholog (KEGG orthology K12886) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080739 IRAL001O03 pOTB7 BC000355 NM_031263 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081619 M01C004A19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081667 M01C004C19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081715 M01C004E19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081763 M01C004G19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081811 M01C004I19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081859 M01C004K19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081907 M01C004M19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE081955 M01C004O19 pDONR221 04-134-2_2-E10 BC014980 NM_031263  
HGE110435 M01C076B11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110483 M01C076D11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110531 M01C076F11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110579 M01C076H11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110627 M01C076J11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110675 M01C076L11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110723 M01C076N11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE110771 M01C076P11 pDONR221 06-2_01-G06 BC014980 NM_031263  
HGE100817 M01C052A17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE100865 M01C052C17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE100913 M01C052E17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE100961 M01C052G17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE101009 M01C052I17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE101057 M01C052K17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE101105 M01C052M17 pDONR221 MGC15-E09 BC014980 NM_031263  
HGE101153 M01C052O17 pDONR221 MGC15-E09 BC014980 NM_031263  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025204 W01A063A04 pENTR-TOPO IRAL001O03 BC000355 NM_031263  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044831 ARe12B07 pKA1U5 NM_002140.3  
GGAGAAAGGAGGAGGGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCT
HKR059726 ARe49F06 pKA1U5 NM_002140.3  
GATGCGACAGCACTGCACACGCCATTATCCTCCCCTTNNNGCTGCACCGACCTCGACGAT
HKR063371 ARe58H03 pKA1U5 NM_002140.3  
GGCGCTCCAGGCGACAGCACTGCAGACGCCATCNTTNTCTGTTTCTCTGCTGCACCGACC
HKR064835 ARe62B11 pKA1U5 NM_002140.3  
GGCGCTCGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCA
HKR072522 ARe81F02 pKA1U5 NM_002140.3  
GGAAAGGAGGAGGGCGCTCCAGGCGCACAGCATTGCAGACGCCATTATCCTCTGTTTCTC
HKR073699 ARe84E03 pKA1U5 NM_002140.3  
GGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCTACTGCAGCACTGGGGTGTCAGTT
HKR076054 ARe90C06 pKA1U5 NM_002140.3  
GGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCT
HKR164171 ARi10H03 pGCAP10 NM_002140.3  
GGCGCTCGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCA
HKR173656 ARi34C08 pGCAP10 NM_002140.3  
GAGACGCCATTATCCTCTGTTTCTCTGCTGCACCGACCTCGACGTCTTGCCTGTGTCCCA
HKR186098 ARi65E02 pGCAP10 NM_002140.3  
ATTATCCTCTGTTTCTCTGCTGCACCGACCTCGACGTCTTGCCTGTGTCCCACTTGTTCG
HKR209363 ARiS023G19 pGCAP10 NM_002140.3  
TCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCTACTGCAGCACTGGGGT
HKR234076 ARiS085D04 pGCAP10 NM_002140.3  
GGAGAAAGGAGGAGGGCGCTCCAGGCGACAGCACTGCAGACGCCATTATCCTCTGTTTCT
HKR234373 ARiS085P13 pGCAP10 NM_002140.3  
GGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCG
HKR235526 ARiS088N14 pGCAP10 NM_002140.3  
GGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCG
HKR238602 ARiS096I10 pGCAP10 NM_002140.3  
GGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCTACTGCAGCACTGGGGTGT
HKR238639 ARiS096J23 pGCAP10 NM_002140.3  
GAGACGCCATTATCCTCTGTTTCTCTGCTGCACCGACCTCGACGTCTTGCCTGTGTCCCA
HKR243778 ARiS109H10 pGCAP10 NM_002140.3  
GGCGCTCGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCA
HKR276756 ARiS191O20 pGCAP10 NM_002140.3  
GGAGAAAGGAGGAGGGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCT
HKR329376 RBb23H08 pGCAP1 NM_002140.3  
GAGGGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCTCTGCTGCACCG
HKR335602 RBb39A02 pGCAP1 NM_002140.3  
GGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCTCTGCTGCACCGACC
HKR347373 RBb68H05 pGCAP1 NM_002140.3  
TTTTGGTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGT
HKR348977 RBb72H09 pGCAP1 NM_002140.3  
AGGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCTCTGCTGCACCGACCT
HKR367726 RBd19F06 pGCAP10 NM_002140.3  
GGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCTCTGCTGCACCGACC
HKR376932 RBd42F12 pGCAP10 NM_002140.3  
GGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCT
HKR381258 RBd53C10 pGCAP10 NM_002140.3  
GGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCT
HKR387658 RBd69C10 pGCAP10 NM_002140.3  
GGGGCGCTCCAGGCCACCGCATTGCAGACTCCATTATCCTCTGTTTCTCTGCTGCACCGA
HKR392883 RBd82D11 pGCAP10 NM_002140.3  
GGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCTACTGCAGCACTGGGGTGTCAGTTG
HKR393376 RBd83H08 pGCAP10 NM_002140.3  
GGAGGNNNNTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCTCTGCTGCACC
HKR395282 RBd88D10 pGCAP10 NM_002140.3  
GGTTTTTCTGTCTAGCTCCGACCGGCTGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTC
HKR398123 RBd95F03 pGCAP10 NM_002140.3  
GGAGGCGGCGCGGCAGCGGAGGGACGGCAGTCTCGCACGGCTACTGCAGCACTGGGGTGT
HKR408870 RBdS022C22 pGCAP10 NM_002140.3  
GGAGAAAGGAGGAGGGCGCTCCAGGCGACAGCATTGCAGACGCCATTATCCTCTGTTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl