Prev. |  KEGG KO K12898 > 

RIKEN DNA Bank Human Resource - HNRNPH3

Gene ID NCBI Gene 3189 |  KEGG hsa:3189
Gene Symbol HNRNPH3
Protein Name heterogeneous nuclear ribonucleoprotein H3
Synonyms 2H9|HNRPH3
Ortholog resource in our bank

  HNRNPH3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033980 IRAK084P20 pCMV-SPORT6 BC039824 NM_021644 Full
HGY085774 IRAL014H06 pOTB7 BC004511 NM_021644 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050177 ARe25H09 pKA1U5 NM_012207.2 done
GGTCACNGCTTGGAGACGGCGGGGAGAACCGTTCCGTNGAGCGCCTACACGAGGCAAACG
HKR362477 RBd06D05 pGCAP10 NM_012207.2  
GGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAACCGTTGTGGCGAGCG
HKR362977 RBd07H09 pGCAP10 NM_012207.2  
AGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAACCGTT
HKR367679 RBd19D07 pGCAP10 NM_012207.2  
GAGTACCTGCGCTGCGCAGCTCCCTAAGCGGTTGTCCCCCCTGGANACGGTTGGGAGAAC
HKR371701 RBd29E05 pGCAP10 NM_012207.2  
GGGGAGAACCGTTGTGGCGAGCGCTACACGAGGCAAACGACTTCTCCCTTCTTTGAACTG
HKR376925 RBd42F05 pGCAP10 NM_012207.2  
GGTCACCGCTGGAGACGGTTGGGAGAACCGTTGTGGCGAGCGCTACACGAGGCAAACGAC
HKR388908 RBd72E12 pGCAP10 NM_012207.2  
GAGTAGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAAC
HKR430084 RBdS075D12 pGCAP10 NM_012207.2  
GAGTAGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl