Prev. |  KEGG KO K12898 > 

RIKEN DNA Bank Human Resource - HNRNPH3

Gene ID NCBI Gene 3189 |  KEGG hsa:3189
Gene Symbol HNRNPH3
Protein Name heterogeneous nuclear ribonucleoprotein H3
Synonyms 2H9|HNRPH3
Ortholog resources KEGG ortholog (KEGG orthology K12898) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX033980 IRAK084P20 pCMV-SPORT6 BC039824 NM_021644 Full
HGY085774 IRAL014H06 pOTB7 BC004511 NM_021644 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050177 ARe25H09 pKA1U5 NM_012207.2 done
GGTCACNGCTTGGAGACGGCGGGGAGAACCGTTCCGTNGAGCGCCTACACGAGGCAAACG
HKR362477 RBd06D05 pGCAP10 NM_012207.2  
GGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAACCGTTGTGGCGAGCG
HKR362977 RBd07H09 pGCAP10 NM_012207.2  
AGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAACCGTT
HKR367679 RBd19D07 pGCAP10 NM_012207.2  
GAGTACCTGCGCTGCGCAGCTCCCTAAGCGGTTGTCCCCCCTGGANACGGTTGGGAGAAC
HKR371701 RBd29E05 pGCAP10 NM_012207.2  
GGGGAGAACCGTTGTGGCGAGCGCTACACGAGGCAAACGACTTCTCCCTTCTTTGAACTG
HKR376925 RBd42F05 pGCAP10 NM_012207.2  
GGTCACCGCTGGAGACGGTTGGGAGAACCGTTGTGGCGAGCGCTACACGAGGCAAACGAC
HKR388908 RBd72E12 pGCAP10 NM_012207.2  
GAGTAGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAAC
HKR430084 RBdS075D12 pGCAP10 NM_012207.2  
GAGTAGCTGTGCTGCGCAGCTCCCTAAGCGGTTGTCACCGCTGGAGACGGTTGGGAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl