Prev. |  KEGG KO K12898 > 

RIKEN DNA Bank Human Resource - HNRNPH2

Gene ID NCBI Gene 3188 |  KEGG hsa:3188
Gene Symbol HNRNPH2
Protein Name heterogeneous nuclear ribonucleoprotein H2
Synonyms FTP3|HNRPH'|HNRPH2|MRXSB|NRPH2|hnRNPH'
Ortholog resources KEGG ortholog (KEGG orthology K12898) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172431 ARi31B07 pGCAP10 NM_019597.3  
GGATTACTCGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCGTCTCGCTATAGC
HKR174945 ARi37G01 pGCAP10 NM_019597.3  
GAGGCGCTCACGTGATTACTCGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCG
HKR324050 RBb10C02 pKA1U5 NM_019597.3  
GACTCGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCGTCTCGCTATAGCCGTT
HKR342176 RBb55H08 pGCAP1 NM_019597.3  
GTGGCTCACGTGATTACTCGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCGTC
HKR362831 RBd07B07 pGCAP10 NM_019597.3  
GGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCGTCTCGCTATAGCCGTTTGAG
HKR380928 RBd52F08 pGCAP10 NM_019597.3  
GAGAAGTAGTTCTGGTCGTCGTCTACCGTCTCGCTATAGCCGTTTGAGGGAAGAAGGAGG
HKR385673 RBd64D01 pGCAP10 NM_019597.3  
GGCTTACGTGAGCAGAAGTAGTTCTGGTCGTCGTCTACCGTCTCGCTATAGCCGTTTGAG
HKR390425 RBd76B01 pGCAP10 NM_019597.3  
TTGGCCGGGAAGCCGCCTGTGCTGCGCCTGGTGGGGAAATGGTGGACGCTCATGACTGTC
HKR390529 RBd76F09 pGCAP10 NM_019597.3  
TTGGCCGGGAAGCCGCCTGTGCTGCGCCTGGTGGGGAAATGGTGGACGCTCATGACTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl