Prev. |  KEGG KO K12898 > 

RIKEN DNA Bank Human Resource - HNRNPH1

Gene ID NCBI Gene 3187 |  KEGG hsa:3187
Gene Symbol HNRNPH1
Protein Name heterogeneous nuclear ribonucleoprotein H1
Synonyms HNRPH|HNRPH1|hnRNPH
Ortholog resources KEGG ortholog (KEGG orthology K12898) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080698 IRAL001M10 pOTB7 BC001348 NM_005520 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076450 ARe91C02 pKA1U5 NM_005520.1  
GCATTTCGTCTTAGCCACGCAGAAGTCGCGTGTCTAGTTTTGTTTCGACGCCGGACCGCG
HKR222106 ARiS055E10 pGCAP10 NM_005520.1  
ATTTTCGTCTTANCCACNCNNAAGTCGCGTGTCTAGGTGAGTCGCGGTGGGTCCTCGCTT
HKR391774 RBd79H06 pGCAP10 NM_005520.1  
GAGANNNNNNGTGNCTAGTTTGTTTCGACGCCGGACCGCGTAAGAGACGATGATGTTGGG
HKR441984 RBdS104P24 pGCAP10 NM_005520.1  
GCATTTCGTCTTAGCCACGCAGAAGTCGCGTGTCTAGGTGAGTCGCGGTGGGTCCTCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl