Prev. |  KEGG KO K12898 > 

RIKEN DNA Bank Human Resource - HNRNPF

Gene ID NCBI Gene 3185 |  KEGG hsa:3185
Gene Symbol HNRNPF
Protein Name heterogeneous nuclear ribonucleoprotein F
Synonyms HNRPF|OK/SW-cl.23|mcs94-1
Ortholog resources KEGG ortholog (KEGG orthology K12898) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081633 IRAL004B09 pOTB7 BC001432 NM_004966 Full
HGY085462 IRAL013K22 pOTB7 BC004254 NM_004966 Full
HGY092894 IRAL032D22 pDNR-LIB BC016736 NM_004966 Full/var
HGY093259 IRAL033C11 pOTB7 BC015580 NM_004966 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041932 W01A104N20 pENTR-TOPO flj0033e04 AK001364 NM_004966  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR222020 ARiS055A20 pGCAP10 NM_004966.3  
GAGCTCTCGGCCCTGGGCCCTTTTTCCTCCTCGGCTGCGCCGCGTGTCCTCGGAGCGCGG
HKR277708 ARiS194E12 pGCAP10 NM_004966.3  
GACGTCCGGCTGCCGGTCTTGGATCACGAGGCCTCCGCTTCCCGGACTCCGGACCCCGCG
HKR342026 RBb55B02 pGCAP1 NM_004966.3  
GGGGCCCTTTTTCCTCCTCGGCTGCGCCGCGTGTCCTCGGAGCGCGGTCCCTGTATTGGT
HKR345703 RBb64E07 pGCAP1 NM_004966.3  
GCTGCCGGGCCGGGCGGTCCGAGGCTGCTGGAGTGCCGTGAGCAGGCCGCGGGAACGTCG
HKR368523 RBd21F03 pGCAP10 NM_004966.3  
GGGGCCGGGCGGTCCGAGGCTGCTGGAGTGCCGTGAGCAGGCCGCGGGAACGTCGCCGTC
HKR371327 RBd28F07 pGCAP10 NM_004966.3  
GGGTGACATCTTGGCGGGCCCGGCAATGGCACTTCCTCCTCTGCACCCCGTGACCCACGT
HKR377324 RBd43F04 pGCAP10 NM_004966.3  
GAGCTCTCGGCCCTGGGCCCTTTTTCCTCCTCGGCTGCGCCGCGTGTCCTCGGAGCGCGG
HKR382456 RBd56C08 pGCAP10 NM_004966.3  
GCCTTGCGTCCTTCCGGCTCCGTCGTGGAAGCAGGACTGCGCCGCGTCTTCCTCAAGGTT
HKR391277 RBd78D05 pGCAP10 NM_004966.3  
GCTTTTTTTTTCCTCCTCGGCTGCGCCGCGTGTCCTCGGAGCGCGGTCCCTGTATTGGTC
HKR392128 RBd80F08 pGCAP10 NM_004966.3  
GGTGGAAGCAGGACTGCGCCGCGTCTTCCTCAAGGTTGAGAACAAAAACATGCACCTGGA
HKR405466 RBdS013L02 pGCAP10 NM_004966.3  
GGGGGCCGACCTTCCTGCCGGGCCGGGCGGTCCGAGGCTGCTGGAGTGCCGTGAGCAGGC
HKR432498 RBdS081E02 pGCAP10 NM_004966.3  
GGCGGTCCGAGGCTGCTGGAGTGCCGTGAGCAGGCCGCGGGAACGTCGCCGTCACCTTGT
HKR442202 RBdS105I10 pGCAP10 NM_004966.3  
GCGTCCTTCCGGCTCCGTCGTGGAAGCAGGACTGCGCCGCGTCTTCCTCAAGGTTGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl