Prev. |  KEGG KO K13044 > 

RIKEN DNA Bank Human Resource - HNRNPD

Gene ID NCBI Gene 3184 |  KEGG hsa:3184
Gene Symbol HNRNPD
Protein Name heterogeneous nuclear ribonucleoprotein D
Synonyms AUF1|AUF1A|HNRPD|P37|hnRNPD0
Ortholog resources KEGG ortholog (KEGG orthology K13044) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB17338 pEF6-FLAG-human AUF1 p37 Expression vector of human AUF1 p37 tagged with FLAG at N-terminus.

webcatalog20210331.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080582 IRAL001H14 pOTB7 BC002401 NM_031370 Full
HGY080922 IRAL002F02 pOTB7 BC023977 NM_002138 Full
HGY084307 IRAL010M19 pOTB7 BC026015 NM_002138 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE017904 W01A044M16 pENTR-TOPO IRAL001H14 BC002401 NM_031370  

♦ W series clone contains a stop codon.

GNP_entry_W01A_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR161649 ARi04C01 pGCAP10 NM_002138.3  
GNGCGGCGCCATTAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTT
HKR162436 ARi06B12 pGCAP10 NM_002138.3  
GCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCT
HKR182032 ARi55B08 pGCAP10 NM_002138.3  
GGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTAT
HKR234376 ARiS085P16 pGCAP10 NM_002138.3  
GTTCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGA
HKR260110 ARiS150E14 pGCAP10 NM_002138.3  
GGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGG
HKR277894 ARiS194M06 pGCAP10 NM_002138.3  
GGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTA
HKR321278 RBb03D06 pKA1U5 NM_002138.3  
GGTTCTTCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGC
HKR323278 RBb08D06 pKA1U5 NM_002138.3  
GGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCGGGAGAG
HKR324451 RBb11C03 pKA1U5 NM_002138.3  
ATTTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCNAGGAGGAGGCGAGAGCGGCCGCCGC
HKR368808 RBd22A08 pGCAP10 NM_002138.3  
GAAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCG
HKR369752 RBd24G08 pGCAP10 NM_002138.3  
TTGGTTCTTCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAG
HKR370551 RBd26G07 pGCAP10 NM_002138.3  
GGTGAGAGGAAGGTATAAAGGGTAGCGAGAGGGCGGGACCGAGGAGGAAAGGGAAAAAAA
HKR383274 RBd58D02 pGCAP10 NM_002138.3  
TGGTTCTTCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCNTTNAAGCGAGGAGGAGG
HKR391232 RBd78B08 pGCAP10 NM_002138.3  
GGCAGAGGTGCAGCCACACCCCGGCCTAACGCTGCTGCTCCCGCCGCTACTGGAGTGGTG
HKR394436 RBd86B12 pGCAP10 NM_002138.3  
GGTCGGCCTTTTTAGGTGGTCCGCGGCGGCGCCGTTAAAGCGAGGAGGAGGCGAGAGCGG
HKR405250 RBdS013C02 pGCAP10 NM_002138.3  
TGCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAG
HKR405346 RBdS013G02 pGCAP10 NM_002138.3  
TGCCGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAG
HKR442268 RBdS105L04 pGCAP10 NM_002138.3  
GAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTTTTAGTGCAGCGG
HKR461731 RBdS154F11 pGCAP10 NM_002138.3  
GGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGGCCGCCGCTGGTGCTTATTCTTTT
HKR462598 RBdS156I06 pGCAP10 NM_002138.3  
GGTCGGCCATTTTAGGTGGTCCGCGGCGGCGCCATTAAAGCGAGGAGGAGGCGAGAGCGG
HKR475160 RBdS187O24 pGCAP10 NM_002138.3  
CAGTAAGAACGAGGAGGATGAAGGCCATTCAAACTCCTCCCCACGACACTCTGAAGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl