Prev. |  KEGG KO K12884 > 

RIKEN DNA Bank Human Resource - HNRNPC

Gene ID NCBI Gene 3183 |  KEGG hsa:3183
Gene Symbol HNRNPC
Protein Name heterogeneous nuclear ribonucleoprotein C (C1/C2)
Synonyms C1|C2|HNRNP|HNRPC|SNRPC
Ortholog resources KEGG ortholog (KEGG orthology K12884) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001506 IRAK003M18 pCMV-SPORT6 BC003394 NM_004500 Partial/var
HGY066845 IRAK167B21 pBluescriptR BC066932 NM_004500 Partial/var
HGY082673 IRAL006L09 pOTB7 BC008364 NM_004500 Partial/var
HGY086655 IRAL016K15 pDNR-LIB BC007052 NM_031314 Partial/var
HGY088625 IRAL021J09 pDNR-LIB BC008423 NM_031314 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044897 ARe12E01 pKA1U5 NM_031314.2  
TGATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGNTTGCCGACCTCCAGCAGC
HKR048956 ARe22G12 pKA1U5 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGNTTGCCGACCTCCAGCAGCA
HKR059775 ARe49H07 pKA1U5 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAG
HKR068930 ARe72F10 pKA1U5 NM_031314.2  
GGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCA
HKR166829 ARi17B05 pGCAP10 NM_031314.2  
ATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGT
HKR168105 ARi20E09 pGCAP10 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTNGCCGACCTCCAGCAGCAG
HKR173325 ARi33F05 pGCAP10 NM_031314.2  
TTTTTTTTTTTTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTC
HKR173603 ARi34A03 pGCAP10 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR184527 ARi61F07 pGCAP10 NM_031314.2  
GGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGC
HKR205217 ARiS013A17 pGCAP10 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR323707 RBb09E11 pKA1U5 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGNTTGCCGACCTCCAGCA
HKR362429 RBd06B05 pGCAP10 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR363749 RBd09G05 pGCAP10 NM_031314.2  
CGGCCGGCCGATGCATTTTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGC
HKR370145 RBd25G01 pGCAP10 NM_031314.2  
GATTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCA
HKR374411 RBd36A11 pGCAP10 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAG
HKR378103 RBd45E07 pGCAP10 NM_031314.2  
GATTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCA
HKR393345 RBd83G01 pGCAP10 NM_031314.2  
GGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAGTCGGC
HKR396007 RBd90A07 pGCAP10 NM_031314.2  
GGCCTTTTTGTGAAGATACCAACACTGATCGGTTGTGGCCGCGTTGCCGACCTCCAGCAC
HKR402889 RBdS007D17 pGCAP10 NM_031314.2  
GATTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCA
HKR405476 RBdS013L12 pGCAP10 NM_031314.2  
GATTTTGTGAAGAGACGAANACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAG
HKR405729 RBdS014F09 pGCAP10 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR408810 RBdS022A10 pGCAP10 NM_031314.2  
GGCCNTTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR430181 RBdS075H13 pGCAP10 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAG
HKR441778 RBdS104H10 pGCAP10 NM_031314.2  
GGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAG
HKR441812 RBdS104I20 pGCAP10 NM_031314.2  
GATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCAGCAG
HKR470922 RBdS177F02 pGCAP10 NM_031314.2  
GGGCCATTTTGTGAAGAGACGAAGACTGAGCGGTTGTGGCCGCGTTGCCGACCTCCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl