Prev. |  KEGG KO K13044 > 

RIKEN DNA Bank Human Resource - HNRNPAB

Gene ID NCBI Gene 3182 |  KEGG hsa:3182
Gene Symbol HNRNPAB
Protein Name heterogeneous nuclear ribonucleoprotein A/B
Synonyms ABBP1|HNRPAB
Ortholog resources KEGG ortholog (KEGG orthology K13044) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086374 IRAL015P14 pOTB7 BC004561 NM_004499 Full
HGY084807 IRAL012A07 pOTB7 BC002625 NM_004499 Full
HGY090746 IRAL026O10 pOTB7 BC009359 NM_004499 Full
HGY092094 IRAL030D22 pOTB7 BC036708 NM_031266 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE049730 W01A124F10 pENTR-TOPO flj0001o09 AK054600 NM_004499  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047356 ARe18G12 pKA1U5 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR171654 ARi29C06 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR173202 ARi33A02 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR323779 RBb09H11 pKA1U5 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR330508 RBb26E12 pGCAP1 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR340150 RBb50G06 pGCAP1 NM_031266.2  
GTAGGGCGGCNGGCACCGCCGCCGGCNACGTGTATCATTGGCTTGCTTGGCTCNNTTGGG
HKR377235 RBd43B11 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR377724 RBd44F04 pGCAP10 NM_031266.2  
GGTCAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCG
HKR380169 RBd50H01 pGCAP10 NM_031266.2  
GAGGCGCNGGCNCNCCGCGGGACGAANCTTGTCTNTTGGCGGTGGTTCCNNNGCGGGGNG
HKR382005 RBd55A05 pGCAP10 NM_031266.2  
GANGNGGNGGCACCGCNGCGGGANGNANCTNGGCTGTTGNNNCNNTNNNNNNGTGNGGCG
HKR382875 RBd57D03 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR386807 RBd67A07 pGCAP10 NM_031266.2  
GGGCGNNNCCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCGGCGG
HKR416324 RBdS040N12 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR432473 RBdS081D01 pGCAP10 NM_031266.2  
GAGGCGGCGGCACCGCGCGGGACGGAGCTTGGCTGTTGGTCGGTGGGTTCCCGTGCGGCG
HKR452874 RBdS132D02 pGCAP10 NM_031266.2  
CGGCCGGCCGATGGGGCGCCACGAGTCGGCATTGTCAGGCGGCGGCACCGCGCGGGACGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl