Prev. |  KEGG KO K12741 > 

RIKEN DNA Bank Human Resource - HNRNPA1

Gene ID NCBI Gene 3178 |  KEGG hsa:3178
Gene Symbol HNRNPA1
Protein Name heterogeneous nuclear ribonucleoprotein A1
Synonyms ALS19|ALS20|HNRPA1|HNRPA1L3|IBMPFD3|UP 1|hnRNP A1|hnRNP-A1
Ortholog resources KEGG ortholog (KEGG orthology K12741) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027308 IRAK068E12 pCMV-SPORT6 BC033714 NM_002136 Full
HGX047601 IRAK119A01 pCMV-SPORT6 BC074502 NM_002136 Full
HGX069826 IRAK174J10 pCMV-SPORT6 BC073162 NM_002136 Full
HGY080552 IRAL001G08 pOTB7 BC002355 NM_002136 Full
HGY085565 IRAL013P05 pOTB7 BC004945 NM_002136 Partial
HGY088447 IRAL021B23 pDNR-LIB BC009600 NM_002136 Full
HGY091791 IRAL029H23 pOTB7 BC012158 NM_002136 Full
HGY102844 IRAL057B20 pDNR-LIB BC070315 NM_002136 Full
HGY103356 IRAL058G12 pOTB7 BC071945 NM_002136 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041674 ARe04D02 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGCTTAAAGTCTCTCTTCACCCTGCC
HKR045205 ARe13A05 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR045626 ARe14B02 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR047636 ARe19B12 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR050012 ARe25A12 pKA1U5 NM_002136.2  
TGGCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGC
HKR051207 ARe28A07 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR052879 ARe32D07 pKA1U5 NM_002136.2  
GCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATG
HKR054459 ARe36C11 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR055373 ARe38H05 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR058405 ARe46A05 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR061632 ARe54B08 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR063610 ARe59A10 pKA1U5 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR064980 ARe62H12 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR065210 ARe63A10 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR066527 ARe66F07 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR069700 ARe74E04 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR070411 ARe76A11 pKA1U5 NM_002136.2  
TCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCCTCNTTAAAGTCTCTCTTCACCCTGCCG
HKR071606 ARe79A06 pKA1U5 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR075370 ARe88H02 pKA1U5 NM_002136.2  
ATCCTGGCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACC
HKR076145 ARe90G01 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR076169 ARe90H01 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR076431 ARe91B07 pKA1U5 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR076570 ARe91H02 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGCTTAAAGTCTCTCTTCACCCTGCCG
HKR078574 ARe96H06 pKA1U5 NM_002136.2  
ATCCTGGCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACC
HKR080881 ARf02D09 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR081626 ARf04B02 pKA1U5 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR162097 ARi05E01 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR164073 ARi10D01 pGCAP10 NM_002136.2  
GCTTNTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCNGCCG
HKR164979 ARi12H11 pGCAP10 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR166030 ARi15B06 pGCAP10 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR175731 ARi39F11 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACNCCGCCGAAGAAACATCGCTAAAGTCTCTCTTCACCCTGCCG
HKR176931 ARi42F11 pGCAP10 NM_002136.2  
GCTTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR178523 ARi46F03 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR184178 ARi60H10 pGCAP10 NM_002136.2  
GGTTAAAGTCTCTCTTCACCCTGCCGTCATGTCTAAGTCAGAGTCTCCTAAAGAGCCCGA
HKR185723 ARi64F03 pGCAP10 NM_002136.2  
HKR186149 ARi65G05 pGCAP10 NM_002136.2  
TTGGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTCTA
HKR187721 ARi69F01 pGCAP10 NM_002136.2  
GGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTC
HKR203247 ARiS008B23 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR203289 ARiS008D17 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR218203 ARiS045I11 pGCAP10 NM_002136.2  
CGGCCGGCCGATTGCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCA
HKR219791 ARiS049H23 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR219873 ARiS049L09 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR234025 ARiS085B01 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR235153 ARiS087O17 pGCAP10 NM_002136.2  
HKR238600 ARiS096I08 pGCAP10 NM_002136.2  
AGCCTTTCTGCCCGTGGACGCCGCCNAANAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR243728 ARiS109F08 pGCAP10 NM_002136.2  
ATTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR243744 ARiS109F24 pGCAP10 NM_002136.2  
GCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATG
HKR248992 ARiS122H24 pGCAP10 NM_002136.2  
GCTTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR249170 ARiS122P10 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR260107 ARiS150E11 pGCAP10 NM_002136.2  
TGGCCCGTGGACGCCGCCNNNGAANCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGT
HKR264668 ARiS161L04 pGCAP10 NM_002136.2  
GCTTTTCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCT
HKR276540 ARiS191F20 pGCAP10 NM_002136.2  
TGCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR276645 ARiS191K05 pGCAP10 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR320500 RBb01E04 pKA1U5 NM_002136.2  
GGCAGTGCGCGTCGGGAAGGCGGCGGGCTATCCGGTCCTCGGCTGCGGCGGGCACCATGG
HKR321701 RBb04E05 pKA1U5 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTTAAAGTCTCTCTTCACCCTGC
HKR322827 RBb07B03 pKA1U5 NM_002136.2  
TTTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR324084 RBb10D12 pKA1U5 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTTAAAGTCTCTCTTCACCCTGCC
HKR325747 RBb14G03 pKA1U5 NM_002136.2  
GGTCAGCTTGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCT
HKR327250 RBb18C02 pKA1U5 NM_002136.2  
GTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGCTTAAAGTCTCTCTTCACCCTGCCGT
HKR329656 RBb24C08 pGCAP1 NM_002136.2  
GCCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR332128 RBb30F08 pGCAP1 NM_002136.2  
GGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGCTTAAAGTCTCTCTTCACCCT
HKR334860 RBb37C12 pGCAP1 NM_002136.2  
TGCCTTTCTGCCCGCGGCACGCCGCCGTAANAAGCATCGCTTAAAGCTCATCGTCATTCA
HKR336549 RBb41G05 pGCAP1 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR338853 RBb47C05 pGCAP1 NM_002136.2  
TTCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGNTTAAAGTCTCTCTTCACCCTGC
HKR340924 RBb52F04 pGCAP1 NM_002136.2  
TGTTTTCTGCCCGATGGGACGCCGCCCGAAAGNAAGCATCGNTTAAAGCTCTTCTTCTTT
HKR343348 RBb58G04 pGCAP1 NM_002136.2  
TGCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR344060 RBb60C12 pGCAP1 NM_002136.2  
GGGCAGATACGTTCGTCAGCTTGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCG
HKR348898 RBb72E02 pGCAP1 NM_002136.2  
TCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATG
HKR360479 RBd01D07 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR362859 RBd07C11 pGCAP10 NM_002136.2  
GCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATG
HKR364502 RBd11E06 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR365606 RBd14A06 pGCAP10 NM_002136.2  
TGGCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR366098 RBd15E02 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR366474 RBd16D02 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR366525 RBd16F05 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR366979 RBd17H11 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR368060 RBd20C12 pGCAP10 NM_002136.2  
GCCTTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGC
HKR368098 RBd20E02 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR369725 RBd24F05 pGCAP10 NM_002136.2  
GCTTTCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTG
HKR370030 RBd25B06 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR370055 RBd25C07 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR372856 RBd32C08 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR372953 RBd32G09 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR373204 RBd33A04 pGCAP10 NM_002136.2  
GGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTC
HKR373604 RBd34A04 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR375277 RBd38D05 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR376572 RBd41H04 pGCAP10 NM_002136.2  
GGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTG
HKR377208 RBd43A08 pGCAP10 NM_002136.2  
GGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTC
HKR378970 RBd47H02 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR380031 RBd50B07 pGCAP10 NM_002136.2  
GTTTGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACC
HKR380174 RBd50H06 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGANCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR382131 RBd55F11 pGCAP10 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCNCNCTTCACCCTGCCG
HKR382176 RBd55H08 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCNNTNNTCACCCTGCCGT
HKR383751 RBd59G07 pGCAP10 NM_002136.2  
GGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATGTC
HKR386858 RBd67C10 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR386873 RBd67D01 pGCAP10 NM_002136.2  
GCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCATG
HKR390954 RBd77G10 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR392076 RBd80D04 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR392410 RBd81A10 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR392482 RBd81D10 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR393369 RBd83H01 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR394807 RBd87A07 pGCAP10 NM_002136.2  
TGGTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTG
HKR396521 RBd91F01 pGCAP10 NM_002136.2  
GTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCAT
HKR396551 RBd91G07 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR397721 RBd94F01 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR397775 RBd94H07 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR398084 RBd95D12 pGCAP10 NM_002136.2  
GCTTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR398170 RBd95H02 pGCAP10 NM_002136.2  
GAGGGCGAAGGTAGGCTGGCAGATACGTTCGTCAGCTTGCTCCTTTCTGCCCGTGGACGC
HKR403072 RBdS007L08 pGCAP10 NM_002136.2  
GTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGTCAT
HKR405341 RBdS013F21 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR405764 RBdS014G20 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR408845 RBdS022B21 pGCAP10 NM_002136.2  
GTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCC
HKR409065 RBdS022L01 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR416258 RBdS040K18 pGCAP10 NM_002136.2  
TGCTTTTCTGCCCGTGGGCGCCNNNNANNAAGCATCGTTGANGTCNCTCTTCNCCCTGCC
HKR428035 RBdS070B11 pGCAP10 NM_002136.2  
TGGTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTG
HKR433250 RBdS083C02 pGCAP10 NM_002136.2  
GCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGCCG
HKR452840 RBdS132B16 pGCAP10 NM_002136.2  
GAGATACGTTCGTCAGCTTGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTA
HKR452987 RBdS132H19 pGCAP10 NM_002136.2  
GAGATACGTTCGTCAGCTTGCTCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTA
HKR461898 RBdS154M10 pGCAP10 NM_002136.2  
GCTTTCTGCCCGTGGACCCCGCCGAAGAANCATCGTTAAAGTCTCTCTTCACCCTGCCGT
HKR462539 RBdS156F19 pGCAP10 NM_002136.2  
GGAGGGCGAAGGTAGGCTGGCAGATACGTTCGTCAGCTTGCTCCTTTCTGCCCGTGGACG
HKR471111 RBdS177M23 pGCAP10 NM_002136.2  
AAGCCTTTCTGCCCGTGGACGCCGCCGAAGAAGCATCGTTAAAGTCTCTCTTCACCCTGC
HKR475012 RBdS187I20 pGCAP10 NM_002136.2  
GTCCTTGCTGCCCGTGNACGCCGCCGAGGANGCATCGTTCNCGTCTCTCTTCANNNNGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl