Prev. |  KEGG KO K09349 > 

RIKEN DNA Bank Human Resource - HMX1

Gene ID NCBI Gene 3166 |  KEGG hsa:3166
Gene Symbol HMX1
Protein Name H6 family homeobox 1
Synonyms H6|NKX5-3
Ortholog resource in our bank

  HMX1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380831 RBd52B07 pGCAP10 NM_018942.2 done
GAGCGGTCCGGGTAGCAGCTCCAGGGCCGGCCCGCGCGTGCGCCCGGGAGCCGCGCGCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl