Prev. |  KEGG KO K00510 > 

RIKEN DNA Bank Human Resource - HMOX2

Gene ID NCBI Gene 3163 |  KEGG hsa:3163
Gene Symbol HMOX2
Protein Name heme oxygenase 2
Synonyms HO-2
Ortholog resources KEGG ortholog (KEGG orthology K00510) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB01671 pHHO2-1 Human a non-inducible type of heme oxygenase isozyme cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080534 IRAL001F14 pOTB7 BC002396 NM_002134 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053231 ARe33B07 pKA1U5 NM_002134.2  
GGCGCCGGCCTCGCGCCAGTCCGCTGGGCTGCACGNTTCTGCGGCGCCTGAGGGAGTCGC
HKR174951 ARi37G07 pGCAP10 NM_002134.2  
GGCCTGAGGGAGTCGCTGACGGGCACGCTGACTGGAGGCTGGCGGACAGGCGACAGCGAC
HKR337656 RBb44C08 pGCAP1 NM_002134.2  
GACTGCGGCGCCTGAGGGAGTCGCTGACGGGCACGCTGACTGGAGGCTGGCGGACAGGCG
HKR395634 RBd89B10 pGCAP10 NM_002134.2  
GGCCTGAGGGAGTCGCTGACGGGCACGCTGACTGGAGGCTGGCGGACAGGCGACAGCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl